FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624934_at:

>probe:Drosophila_2:1624934_at:47:45; Interrogation_Position=2167; Antisense; ATCGCCGCCCGAATTGGCCGGAATG
>probe:Drosophila_2:1624934_at:540:369; Interrogation_Position=2187; Antisense; GAATGACACTGGAGGCACGTCTGAT
>probe:Drosophila_2:1624934_at:261:355; Interrogation_Position=2201; Antisense; GCACGTCTGATATCCTACGACTGGG
>probe:Drosophila_2:1624934_at:71:653; Interrogation_Position=2230; Antisense; TCAATTTGGCGAATTCCAGGAGGCC
>probe:Drosophila_2:1624934_at:118:715; Interrogation_Position=2243; Antisense; TTCCAGGAGGCCACACGCAAGGGCA
>probe:Drosophila_2:1624934_at:621:81; Interrogation_Position=2262; Antisense; AGGGCAGCTTCAAGCCCATTTGCTG
>probe:Drosophila_2:1624934_at:568:109; Interrogation_Position=2295; Antisense; AGAATCATGGCTCCGAGTTTCTCGA
>probe:Drosophila_2:1624934_at:521:295; Interrogation_Position=2308; Antisense; CGAGTTTCTCGAGGGCTACAGCATA
>probe:Drosophila_2:1624934_at:259:189; Interrogation_Position=2344; Antisense; AACGTACAAGAAGCACCGTCGGTGC
>probe:Drosophila_2:1624934_at:402:303; Interrogation_Position=2441; Antisense; CCGGTGCTGCACGAGTTGGACAACA
>probe:Drosophila_2:1624934_at:249:187; Interrogation_Position=2465; Antisense; AACAACATCATCGAGGGAGCGGCGC
>probe:Drosophila_2:1624934_at:71:287; Interrogation_Position=2584; Antisense; CTGGTGGCTCCTGCTAATGCTAAGG
>probe:Drosophila_2:1624934_at:168:39; Interrogation_Position=2669; Antisense; ACCACCGTCTCAATACACTAAACTA
>probe:Drosophila_2:1624934_at:456:143; Interrogation_Position=2690; Antisense; ACTAACCGTACAGCTGAAGTGCAGT

Paste this into a BLAST search page for me
ATCGCCGCCCGAATTGGCCGGAATGGAATGACACTGGAGGCACGTCTGATGCACGTCTGATATCCTACGACTGGGTCAATTTGGCGAATTCCAGGAGGCCTTCCAGGAGGCCACACGCAAGGGCAAGGGCAGCTTCAAGCCCATTTGCTGAGAATCATGGCTCCGAGTTTCTCGACGAGTTTCTCGAGGGCTACAGCATAAACGTACAAGAAGCACCGTCGGTGCCCGGTGCTGCACGAGTTGGACAACAAACAACATCATCGAGGGAGCGGCGCCTGGTGGCTCCTGCTAATGCTAAGGACCACCGTCTCAATACACTAAACTAACTAACCGTACAGCTGAAGTGCAGT

Full Affymetrix probeset data:

Annotations for 1624934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720