FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624935_at:

>probe:Drosophila_2:1624935_at:182:531; Interrogation_Position=1264; Antisense; GGGTAGCACTCAAAACTGCCTGACT
>probe:Drosophila_2:1624935_at:224:609; Interrogation_Position=1284; Antisense; TGACTGCCTGTAAACGGTTCCTGGA
>probe:Drosophila_2:1624935_at:124:585; Interrogation_Position=1305; Antisense; TGGACTCGGGCCAATCATGTGTGGT
>probe:Drosophila_2:1624935_at:79:157; Interrogation_Position=1335; Antisense; ACACCAATGTGGATGCAGCTTCTCG
>probe:Drosophila_2:1624935_at:463:163; Interrogation_Position=1364; Antisense; AAATTCTTGCAGTTGGCCAGCGAAA
>probe:Drosophila_2:1624935_at:177:389; Interrogation_Position=1385; Antisense; GAAAAGATGATTCCATGCCGCTGCC
>probe:Drosophila_2:1624935_at:162:51; Interrogation_Position=1399; Antisense; ATGCCGCTGCCTTGTGATGAATGTG
>probe:Drosophila_2:1624935_at:695:369; Interrogation_Position=1417; Antisense; GAATGTGCCCGTCGCCCAAGTGAAG
>probe:Drosophila_2:1624935_at:605:115; Interrogation_Position=1450; Antisense; AGCTTTCCGAGAGCTATCAGACTCC
>probe:Drosophila_2:1624935_at:270:71; Interrogation_Position=1526; Antisense; CAGGAACCCGCCCTAGACGAAGGAT
>probe:Drosophila_2:1624935_at:549:517; Interrogation_Position=1567; Antisense; GGTGAACTTTAAGCCCAATTTTGCG
>probe:Drosophila_2:1624935_at:531:685; Interrogation_Position=1675; Antisense; TATACGCTTAGCTATATCGGCGATC
>probe:Drosophila_2:1624935_at:705:39; Interrogation_Position=1690; Antisense; ATCGGCGATCAACCAGTCCATGGAG
>probe:Drosophila_2:1624935_at:279:587; Interrogation_Position=1710; Antisense; TGGAGCTAAGCAGTTTCTCGCCAGT

Paste this into a BLAST search page for me
GGGTAGCACTCAAAACTGCCTGACTTGACTGCCTGTAAACGGTTCCTGGATGGACTCGGGCCAATCATGTGTGGTACACCAATGTGGATGCAGCTTCTCGAAATTCTTGCAGTTGGCCAGCGAAAGAAAAGATGATTCCATGCCGCTGCCATGCCGCTGCCTTGTGATGAATGTGGAATGTGCCCGTCGCCCAAGTGAAGAGCTTTCCGAGAGCTATCAGACTCCCAGGAACCCGCCCTAGACGAAGGATGGTGAACTTTAAGCCCAATTTTGCGTATACGCTTAGCTATATCGGCGATCATCGGCGATCAACCAGTCCATGGAGTGGAGCTAAGCAGTTTCTCGCCAGT

Full Affymetrix probeset data:

Annotations for 1624935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720