FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624937_at:

>probe:Drosophila_2:1624937_at:179:265; Interrogation_Position=1011; Antisense; CAGACGCTTCTAGATGATAGGCCTA
>probe:Drosophila_2:1624937_at:272:457; Interrogation_Position=1026; Antisense; GATAGGCCTATCAACGTGGAGCGCT
>probe:Drosophila_2:1624937_at:578:197; Interrogation_Position=1038; Antisense; AACGTGGAGCGCTATCAAGTCAAAA
>probe:Drosophila_2:1624937_at:441:143; Interrogation_Position=1064; Antisense; ACTGGGTGCCAAGCAAGTGCGCGAT
>probe:Drosophila_2:1624937_at:130:119; Interrogation_Position=1103; Antisense; AGCTGCTTCGAAAACGTCCTCAAAG
>probe:Drosophila_2:1624937_at:40:109; Interrogation_Position=1138; Antisense; AGAACCAGAATTCTGCGGGCGCAAA
>probe:Drosophila_2:1624937_at:346:211; Interrogation_Position=1210; Antisense; AAGAAGGAGCACCTACTGGTCAAAA
>probe:Drosophila_2:1624937_at:547:229; Interrogation_Position=1305; Antisense; AATGACCAACAAACGGCTCTTGCCA
>probe:Drosophila_2:1624937_at:165:429; Interrogation_Position=1411; Antisense; GAGATTCGTTTGACTTTCTGTTACG
>probe:Drosophila_2:1624937_at:468:601; Interrogation_Position=1432; Antisense; TACGAAGTTAACCACCGGATCAGTT
>probe:Drosophila_2:1624937_at:502:543; Interrogation_Position=1448; Antisense; GGATCAGTTTCCGTAGCGGACACTA
>probe:Drosophila_2:1624937_at:264:431; Interrogation_Position=952; Antisense; GAGTAGCATACGTCTGTTTCCAAAA
>probe:Drosophila_2:1624937_at:428:499; Interrogation_Position=963; Antisense; GTCTGTTTCCAAAAGCCCGATGCTG
>probe:Drosophila_2:1624937_at:308:283; Interrogation_Position=985; Antisense; CTGTGGGACTAGCTCTTGAACTTAA

Paste this into a BLAST search page for me
CAGACGCTTCTAGATGATAGGCCTAGATAGGCCTATCAACGTGGAGCGCTAACGTGGAGCGCTATCAAGTCAAAAACTGGGTGCCAAGCAAGTGCGCGATAGCTGCTTCGAAAACGTCCTCAAAGAGAACCAGAATTCTGCGGGCGCAAAAAGAAGGAGCACCTACTGGTCAAAAAATGACCAACAAACGGCTCTTGCCAGAGATTCGTTTGACTTTCTGTTACGTACGAAGTTAACCACCGGATCAGTTGGATCAGTTTCCGTAGCGGACACTAGAGTAGCATACGTCTGTTTCCAAAAGTCTGTTTCCAAAAGCCCGATGCTGCTGTGGGACTAGCTCTTGAACTTAA

Full Affymetrix probeset data:

Annotations for 1624937_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720