Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624938_at:

>probe:Drosophila_2:1624938_at:523:445; Interrogation_Position=1165; Antisense; GATGCTGGCGAAGGACTAACTTGTA
>probe:Drosophila_2:1624938_at:491:523; Interrogation_Position=1291; Antisense; GGGCTTAGTTCGACCAGATCGATTG
>probe:Drosophila_2:1624938_at:572:485; Interrogation_Position=1343; Antisense; GTAGGGTATTGTTCAGCCAGCCCGT
>probe:Drosophila_2:1624938_at:725:125; Interrogation_Position=1357; Antisense; AGCCAGCCCGTTAGACTTTTCTGTT
>probe:Drosophila_2:1624938_at:651:217; Interrogation_Position=1415; Antisense; AAGTACCACGTTTCCATGAGAGTCC
>probe:Drosophila_2:1624938_at:448:629; Interrogation_Position=1453; Antisense; TCCTTCTCAGGCGAGGGTCAAATCG
>probe:Drosophila_2:1624938_at:420:421; Interrogation_Position=1486; Antisense; GAGCACCACGGATCATACTACATAG
>probe:Drosophila_2:1624938_at:680:545; Interrogation_Position=1533; Antisense; GGAGCTCATCATCCACATGCGGGTG
>probe:Drosophila_2:1624938_at:259:415; Interrogation_Position=1584; Antisense; GACCAAGAGTTCCTATAGCTGCCGT
>probe:Drosophila_2:1624938_at:208:465; Interrogation_Position=1607; Antisense; GTTGGACCAACATCAACTACGCCAA
>probe:Drosophila_2:1624938_at:103:441; Interrogation_Position=1639; Antisense; GATGGCACCCTGGAGAGGATCGCCT
>probe:Drosophila_2:1624938_at:223:687; Interrogation_Position=1696; Antisense; TTTGTCGCCCGGATCCGGAATAGTG
>probe:Drosophila_2:1624938_at:161:565; Interrogation_Position=1712; Antisense; GGAATAGTGCACTCCAATCACGCCT
>probe:Drosophila_2:1624938_at:380:239; Interrogation_Position=1727; Antisense; AATCACGCCTCGAATGCAGTTCCTA

Paste this into a BLAST search page for me
GATGCTGGCGAAGGACTAACTTGTAGGGCTTAGTTCGACCAGATCGATTGGTAGGGTATTGTTCAGCCAGCCCGTAGCCAGCCCGTTAGACTTTTCTGTTAAGTACCACGTTTCCATGAGAGTCCTCCTTCTCAGGCGAGGGTCAAATCGGAGCACCACGGATCATACTACATAGGGAGCTCATCATCCACATGCGGGTGGACCAAGAGTTCCTATAGCTGCCGTGTTGGACCAACATCAACTACGCCAAGATGGCACCCTGGAGAGGATCGCCTTTTGTCGCCCGGATCCGGAATAGTGGGAATAGTGCACTCCAATCACGCCTAATCACGCCTCGAATGCAGTTCCTA

Full Affymetrix probeset data:

Annotations for 1624938_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime