Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624939_at:

>probe:Drosophila_2:1624939_at:112:505; Interrogation_Position=1109; Antisense; GTGCCAGGAGGTTATTGAAAAGTGC
>probe:Drosophila_2:1624939_at:508:543; Interrogation_Position=1163; Antisense; GGATTTGGTCTATCTAGACCAGGTT
>probe:Drosophila_2:1624939_at:280:309; Interrogation_Position=1474; Antisense; CCAGAATTGGATTGGCTCTCCTGAT
>probe:Drosophila_2:1624939_at:425:727; Interrogation_Position=1485; Antisense; TTGGCTCTCCTGATTAAGGACTTTA
>probe:Drosophila_2:1624939_at:380:73; Interrogation_Position=1501; Antisense; AGGACTTTAAGTTCTCAGTTTGCGA
>probe:Drosophila_2:1624939_at:612:479; Interrogation_Position=1518; Antisense; GTTTGCGAGAAGACAACCATTCCCA
>probe:Drosophila_2:1624939_at:173:423; Interrogation_Position=1524; Antisense; GAGAAGACAACCATTCCCATGACAT
>probe:Drosophila_2:1624939_at:496:251; Interrogation_Position=1531; Antisense; CAACCATTCCCATGACATACAACAA
>probe:Drosophila_2:1624939_at:729:171; Interrogation_Position=1554; Antisense; AAAGAAATGTTCCTTATTGCCAGTA
>probe:Drosophila_2:1624939_at:566:59; Interrogation_Position=1560; Antisense; ATGTTCCTTATTGCCAGTAATTCTG
>probe:Drosophila_2:1624939_at:434:493; Interrogation_Position=1576; Antisense; GTAATTCTGGAATTTATCTGAAGGC
>probe:Drosophila_2:1624939_at:70:365; Interrogation_Position=1585; Antisense; GAATTTATCTGAAGGCTGAGCGAGT
>probe:Drosophila_2:1624939_at:403:285; Interrogation_Position=1600; Antisense; CTGAGCGAGTGTGATGCCTTTTTAA
>probe:Drosophila_2:1624939_at:263:433; Interrogation_Position=1606; Antisense; GAGTGTGATGCCTTTTTAATAAATT

Paste this into a BLAST search page for me
GTGCCAGGAGGTTATTGAAAAGTGCGGATTTGGTCTATCTAGACCAGGTTCCAGAATTGGATTGGCTCTCCTGATTTGGCTCTCCTGATTAAGGACTTTAAGGACTTTAAGTTCTCAGTTTGCGAGTTTGCGAGAAGACAACCATTCCCAGAGAAGACAACCATTCCCATGACATCAACCATTCCCATGACATACAACAAAAAGAAATGTTCCTTATTGCCAGTAATGTTCCTTATTGCCAGTAATTCTGGTAATTCTGGAATTTATCTGAAGGCGAATTTATCTGAAGGCTGAGCGAGTCTGAGCGAGTGTGATGCCTTTTTAAGAGTGTGATGCCTTTTTAATAAATT

Full Affymetrix probeset data:

Annotations for 1624939_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime