FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624940_at:

>probe:Drosophila_2:1624940_at:332:109; Interrogation_Position=1094; Antisense; AGAAGCCCAAGCTGAGTTTCTCCAT
>probe:Drosophila_2:1624940_at:597:429; Interrogation_Position=1107; Antisense; GAGTTTCTCCATCGAATCCATCATG
>probe:Drosophila_2:1624940_at:685:269; Interrogation_Position=551; Antisense; CATCATCTACAAAATCCACGGGCGT
>probe:Drosophila_2:1624940_at:28:493; Interrogation_Position=574; Antisense; GTAACAACGGCCAGTGCCAACAACT
>probe:Drosophila_2:1624940_at:179:723; Interrogation_Position=687; Antisense; TTGCGTTAGCAACTCATCTTCATCC
>probe:Drosophila_2:1624940_at:679:295; Interrogation_Position=721; Antisense; CGACAGGCTCTGATGGCCCAAAAGA
>probe:Drosophila_2:1624940_at:193:425; Interrogation_Position=759; Antisense; GAGACTACGCAGTTTGCAGCAATCC
>probe:Drosophila_2:1624940_at:461:5; Interrogation_Position=786; Antisense; ATTGCATATCACAGCCGCCATGGAA
>probe:Drosophila_2:1624940_at:359:29; Interrogation_Position=813; Antisense; ATACAAACAGCGATTTCCCACGTTC
>probe:Drosophila_2:1624940_at:322:633; Interrogation_Position=841; Antisense; TCGCCATTGATGGAGCGCATGCGCA
>probe:Drosophila_2:1624940_at:104:525; Interrogation_Position=872; Antisense; GGGCATTCGCCGATCCGGAACTGAA
>probe:Drosophila_2:1624940_at:716:329; Interrogation_Position=920; Antisense; GCGGTAACGCTTTGTACTTTGCCAC
>probe:Drosophila_2:1624940_at:26:133; Interrogation_Position=972; Antisense; ACCCGTTCATCAGGAGCAGCACATT
>probe:Drosophila_2:1624940_at:507:113; Interrogation_Position=986; Antisense; AGCAGCACATTTATCACCCGATGCC

Paste this into a BLAST search page for me
AGAAGCCCAAGCTGAGTTTCTCCATGAGTTTCTCCATCGAATCCATCATGCATCATCTACAAAATCCACGGGCGTGTAACAACGGCCAGTGCCAACAACTTTGCGTTAGCAACTCATCTTCATCCCGACAGGCTCTGATGGCCCAAAAGAGAGACTACGCAGTTTGCAGCAATCCATTGCATATCACAGCCGCCATGGAAATACAAACAGCGATTTCCCACGTTCTCGCCATTGATGGAGCGCATGCGCAGGGCATTCGCCGATCCGGAACTGAAGCGGTAACGCTTTGTACTTTGCCACACCCGTTCATCAGGAGCAGCACATTAGCAGCACATTTATCACCCGATGCC

Full Affymetrix probeset data:

Annotations for 1624940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720