FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624941_at:

>probe:Drosophila_2:1624941_at:730:225; Interrogation_Position=2537; Antisense; AAGGAAGAGCATCCGCTGTGTAGCC
>probe:Drosophila_2:1624941_at:535:673; Interrogation_Position=2557; Antisense; TAGCCAGCCATTGGTGAGGACACCC
>probe:Drosophila_2:1624941_at:571:191; Interrogation_Position=2616; Antisense; AACTTGCCGGCAAATCACCACTGGA
>probe:Drosophila_2:1624941_at:336:107; Interrogation_Position=2652; Antisense; AGAAGTCCGTAATAGCTCGCCGGAA
>probe:Drosophila_2:1624941_at:128:275; Interrogation_Position=2670; Antisense; GCCGGAACCTCCTGTCACTAAAAAG
>probe:Drosophila_2:1624941_at:590:723; Interrogation_Position=2711; Antisense; TTGTCAACTGAAACTTCCACTTCCT
>probe:Drosophila_2:1624941_at:624:707; Interrogation_Position=2741; Antisense; TTACCCACTATGGAGCGATTCGCTC
>probe:Drosophila_2:1624941_at:230:631; Interrogation_Position=2788; Antisense; TCCGCTGGCCGACAGGGACTTAAAT
>probe:Drosophila_2:1624941_at:309:555; Interrogation_Position=2803; Antisense; GGACTTAAATCGCTCCAAGGACTGT
>probe:Drosophila_2:1624941_at:569:557; Interrogation_Position=2851; Antisense; GGACATGTCCCCTATTTGCATGCAA
>probe:Drosophila_2:1624941_at:51:493; Interrogation_Position=2931; Antisense; GTAAGCGTTGCTTTATACCCAAAAT
>probe:Drosophila_2:1624941_at:355:5; Interrogation_Position=2954; Antisense; ATATTTAAACCGCTGGCCGATTTGA
>probe:Drosophila_2:1624941_at:258:485; Interrogation_Position=3010; Antisense; GTATGCCATTAGTGGTCTCATCATG
>probe:Drosophila_2:1624941_at:77:663; Interrogation_Position=3101; Antisense; TAAACGATCCGATAAGGGCCACCCG

Paste this into a BLAST search page for me
AAGGAAGAGCATCCGCTGTGTAGCCTAGCCAGCCATTGGTGAGGACACCCAACTTGCCGGCAAATCACCACTGGAAGAAGTCCGTAATAGCTCGCCGGAAGCCGGAACCTCCTGTCACTAAAAAGTTGTCAACTGAAACTTCCACTTCCTTTACCCACTATGGAGCGATTCGCTCTCCGCTGGCCGACAGGGACTTAAATGGACTTAAATCGCTCCAAGGACTGTGGACATGTCCCCTATTTGCATGCAAGTAAGCGTTGCTTTATACCCAAAATATATTTAAACCGCTGGCCGATTTGAGTATGCCATTAGTGGTCTCATCATGTAAACGATCCGATAAGGGCCACCCG

Full Affymetrix probeset data:

Annotations for 1624941_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720