FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624943_at:

>probe:Drosophila_2:1624943_at:729:331; Interrogation_Position=1006; Antisense; GCGGCTAAGTGCATCCTGGTCAAGG
>probe:Drosophila_2:1624943_at:544:511; Interrogation_Position=1037; Antisense; GTGAGTTCCGGCACTACAAGACACT
>probe:Drosophila_2:1624943_at:311:567; Interrogation_Position=1089; Antisense; GGCACACATTAGAACCACGTCCAAT
>probe:Drosophila_2:1624943_at:705:69; Interrogation_Position=1247; Antisense; AGGCCATTGATACCTAATCGCGTCC
>probe:Drosophila_2:1624943_at:623:555; Interrogation_Position=1280; Antisense; GGACGCAGCACACTTTTACACAGTA
>probe:Drosophila_2:1624943_at:580:649; Interrogation_Position=722; Antisense; TCACCGAGGTGCTAGCCCTGTTGGT
>probe:Drosophila_2:1624943_at:292:539; Interrogation_Position=770; Antisense; GGATCATCTACCAGGTTTTCCTCGG
>probe:Drosophila_2:1624943_at:686:699; Interrogation_Position=785; Antisense; TTTTCCTCGGTCTGCGCATCATGGT
>probe:Drosophila_2:1624943_at:62:597; Interrogation_Position=809; Antisense; TGTGGGCGTATGTGTTTGTCAACCT
>probe:Drosophila_2:1624943_at:677:697; Interrogation_Position=841; Antisense; TTTAAGTACTTCATACCCACGCTGT
>probe:Drosophila_2:1624943_at:89:709; Interrogation_Position=878; Antisense; TTAAGCTTTCCCTGAATGTGCCCAT
>probe:Drosophila_2:1624943_at:674:17; Interrogation_Position=901; Antisense; ATTTGGTTGTGGTACGGCCTCTCCA
>probe:Drosophila_2:1624943_at:549:535; Interrogation_Position=939; Antisense; GGTGCTGCAATACTTCTACCATCAG
>probe:Drosophila_2:1624943_at:570:93; Interrogation_Position=962; Antisense; AGATATATCACACAGCGCCGTCGGA

Paste this into a BLAST search page for me
GCGGCTAAGTGCATCCTGGTCAAGGGTGAGTTCCGGCACTACAAGACACTGGCACACATTAGAACCACGTCCAATAGGCCATTGATACCTAATCGCGTCCGGACGCAGCACACTTTTACACAGTATCACCGAGGTGCTAGCCCTGTTGGTGGATCATCTACCAGGTTTTCCTCGGTTTTCCTCGGTCTGCGCATCATGGTTGTGGGCGTATGTGTTTGTCAACCTTTTAAGTACTTCATACCCACGCTGTTTAAGCTTTCCCTGAATGTGCCCATATTTGGTTGTGGTACGGCCTCTCCAGGTGCTGCAATACTTCTACCATCAGAGATATATCACACAGCGCCGTCGGA

Full Affymetrix probeset data:

Annotations for 1624943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720