FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624944_at:

>probe:Drosophila_2:1624944_at:700:65; Interrogation_Position=101; Antisense; ATGGAGATGCTACACTGCTGCTACT
>probe:Drosophila_2:1624944_at:51:335; Interrogation_Position=117; Antisense; GCTGCTACTGTTTGAGCCAAGTTCA
>probe:Drosophila_2:1624944_at:180:281; Interrogation_Position=150; Antisense; CTCTTCTACAATTCTGAGCCTCATT
>probe:Drosophila_2:1624944_at:658:429; Interrogation_Position=182; Antisense; GAGTTTGTGGGTGCATCATTGATGT
>probe:Drosophila_2:1624944_at:470:63; Interrogation_Position=203; Antisense; ATGTGGCATTGATGGTGGCTTTAGC
>probe:Drosophila_2:1624944_at:586:339; Interrogation_Position=220; Antisense; GCTTTAGCCACCTTTAGCCAGGAGT
>probe:Drosophila_2:1624944_at:139:707; Interrogation_Position=233; Antisense; TTAGCCAGGAGTTCGCCAATCGTCC
>probe:Drosophila_2:1624944_at:171:237; Interrogation_Position=250; Antisense; AATCGTCCCAGCCATATTCCCATAT
>probe:Drosophila_2:1624944_at:444:21; Interrogation_Position=263; Antisense; ATATTCCCATATTCCAGACGGCACT
>probe:Drosophila_2:1624944_at:122:103; Interrogation_Position=278; Antisense; AGACGGCACTTTTTGAAGGCTGTAA
>probe:Drosophila_2:1624944_at:694:85; Interrogation_Position=303; Antisense; AGTGCGTTTGTTGGCGTTACTTTAT
>probe:Drosophila_2:1624944_at:2:149; Interrogation_Position=321; Antisense; ACTTTATGGCCGGAACGCATGTAAA
>probe:Drosophila_2:1624944_at:485:199; Interrogation_Position=334; Antisense; AACGCATGTAAACACGTGGCCACGT
>probe:Drosophila_2:1624944_at:103:525; Interrogation_Position=366; Antisense; GGGCTACTTGCCAATCCGGAATCCA

Paste this into a BLAST search page for me
ATGGAGATGCTACACTGCTGCTACTGCTGCTACTGTTTGAGCCAAGTTCACTCTTCTACAATTCTGAGCCTCATTGAGTTTGTGGGTGCATCATTGATGTATGTGGCATTGATGGTGGCTTTAGCGCTTTAGCCACCTTTAGCCAGGAGTTTAGCCAGGAGTTCGCCAATCGTCCAATCGTCCCAGCCATATTCCCATATATATTCCCATATTCCAGACGGCACTAGACGGCACTTTTTGAAGGCTGTAAAGTGCGTTTGTTGGCGTTACTTTATACTTTATGGCCGGAACGCATGTAAAAACGCATGTAAACACGTGGCCACGTGGGCTACTTGCCAATCCGGAATCCA

Full Affymetrix probeset data:

Annotations for 1624944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720