FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624946_at:

>probe:Drosophila_2:1624946_at:332:39; Interrogation_Position=2206; Antisense; ATCTACAGATGTGCTATCGCTTCGC
>probe:Drosophila_2:1624946_at:243:485; Interrogation_Position=2232; Antisense; GTATCCATCCTACTTTACTTCTATG
>probe:Drosophila_2:1624946_at:18:699; Interrogation_Position=2245; Antisense; TTTACTTCTATGCATCCCTATTTGG
>probe:Drosophila_2:1624946_at:112:341; Interrogation_Position=2357; Antisense; GCTAGTGCTCATCCATTTGCTAATT
>probe:Drosophila_2:1624946_at:616:519; Interrogation_Position=2409; Antisense; GTGGCACTGAGCAGCTTTGGACGTC
>probe:Drosophila_2:1624946_at:274:691; Interrogation_Position=2424; Antisense; TTTGGACGTCAGCAGATCCGCACGA
>probe:Drosophila_2:1624946_at:293:47; Interrogation_Position=2439; Antisense; ATCCGCACGATATTCTCCAGTTTGA
>probe:Drosophila_2:1624946_at:37:481; Interrogation_Position=2458; Antisense; GTTTGATGCTCATTTGCAACGCCGT
>probe:Drosophila_2:1624946_at:634:713; Interrogation_Position=2490; Antisense; TTCTTCGTTGTGTTTGTTCCGCATA
>probe:Drosophila_2:1624946_at:82:67; Interrogation_Position=2529; Antisense; ATGGCACATCCATCCGTAGTTCATG
>probe:Drosophila_2:1624946_at:214:679; Interrogation_Position=2545; Antisense; TAGTTCATGCACTTCTGGCCCAATT
>probe:Drosophila_2:1624946_at:560:599; Interrogation_Position=2573; Antisense; TGTCATCCTGATCTTGGCTTGCGAA
>probe:Drosophila_2:1624946_at:617:341; Interrogation_Position=2589; Antisense; GCTTGCGAATCCATAGTGACCATCT
>probe:Drosophila_2:1624946_at:567:511; Interrogation_Position=2604; Antisense; GTGACCATCTTCTTTCGTAGACTTA

Paste this into a BLAST search page for me
ATCTACAGATGTGCTATCGCTTCGCGTATCCATCCTACTTTACTTCTATGTTTACTTCTATGCATCCCTATTTGGGCTAGTGCTCATCCATTTGCTAATTGTGGCACTGAGCAGCTTTGGACGTCTTTGGACGTCAGCAGATCCGCACGAATCCGCACGATATTCTCCAGTTTGAGTTTGATGCTCATTTGCAACGCCGTTTCTTCGTTGTGTTTGTTCCGCATAATGGCACATCCATCCGTAGTTCATGTAGTTCATGCACTTCTGGCCCAATTTGTCATCCTGATCTTGGCTTGCGAAGCTTGCGAATCCATAGTGACCATCTGTGACCATCTTCTTTCGTAGACTTA

Full Affymetrix probeset data:

Annotations for 1624946_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720