Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624948_at:

>probe:Drosophila_2:1624948_at:536:569; Interrogation_Position=1028; Antisense; GGCTTAGGCCAGGAACGATCGTTAA
>probe:Drosophila_2:1624948_at:509:489; Interrogation_Position=1108; Antisense; GTACATCATCGGCAACTCGACATTC
>probe:Drosophila_2:1624948_at:488:9; Interrogation_Position=1129; Antisense; ATTCCACGCGATGCATTTCTAGTTA
>probe:Drosophila_2:1624948_at:271:645; Interrogation_Position=1146; Antisense; TCTAGTTACGTAAGCCAATCTCTGG
>probe:Drosophila_2:1624948_at:75:259; Interrogation_Position=1180; Antisense; CACTTCTGGGCTAGGCCGACTAAAA
>probe:Drosophila_2:1624948_at:29:173; Interrogation_Position=1203; Antisense; AAAGACTTTGTTCGCACTCTGTAGC
>probe:Drosophila_2:1624948_at:47:643; Interrogation_Position=1220; Antisense; TCTGTAGCCCTTAGCCACGTTCATT
>probe:Drosophila_2:1624948_at:525:137; Interrogation_Position=1236; Antisense; ACGTTCATTTCATCGCCTAACTTAA
>probe:Drosophila_2:1624948_at:563:119; Interrogation_Position=755; Antisense; AGCTGATCCAGCTCCCGAAGCAGAT
>probe:Drosophila_2:1624948_at:559:477; Interrogation_Position=798; Antisense; GTCTTAAGCCAAGAAACGCCCGTTG
>probe:Drosophila_2:1624948_at:84:43; Interrogation_Position=811; Antisense; AAACGCCCGTTGATGACGACGACGT
>probe:Drosophila_2:1624948_at:514:169; Interrogation_Position=878; Antisense; AAATGGCCATTATCCAGCGGCTGCA
>probe:Drosophila_2:1624948_at:428:633; Interrogation_Position=947; Antisense; TCCCCAGCCGATTGTTGAACCTGTA
>probe:Drosophila_2:1624948_at:456:241; Interrogation_Position=984; Antisense; AATAGCGTTACAGTCACCGTGGCTT

Paste this into a BLAST search page for me
GGCTTAGGCCAGGAACGATCGTTAAGTACATCATCGGCAACTCGACATTCATTCCACGCGATGCATTTCTAGTTATCTAGTTACGTAAGCCAATCTCTGGCACTTCTGGGCTAGGCCGACTAAAAAAAGACTTTGTTCGCACTCTGTAGCTCTGTAGCCCTTAGCCACGTTCATTACGTTCATTTCATCGCCTAACTTAAAGCTGATCCAGCTCCCGAAGCAGATGTCTTAAGCCAAGAAACGCCCGTTGAAACGCCCGTTGATGACGACGACGTAAATGGCCATTATCCAGCGGCTGCATCCCCAGCCGATTGTTGAACCTGTAAATAGCGTTACAGTCACCGTGGCTT

Full Affymetrix probeset data:

Annotations for 1624948_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime