FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624949_at:

>probe:Drosophila_2:1624949_at:60:711; Interrogation_Position=417; Antisense; TTCACCCACGTGATGGAGGCCAATG
>probe:Drosophila_2:1624949_at:30:251; Interrogation_Position=437; Antisense; CAATGTGCGTTCTGGGTTTTATCTG
>probe:Drosophila_2:1624949_at:397:621; Interrogation_Position=472; Antisense; TGCTGCCCCAGTTGCTGCAGTGTAA
>probe:Drosophila_2:1624949_at:70:83; Interrogation_Position=496; Antisense; AGGGCAGCATTGTCAACGTGTCCAG
>probe:Drosophila_2:1624949_at:699:277; Interrogation_Position=557; Antisense; CTACAACATGTCCAAGGCGGCGGTG
>probe:Drosophila_2:1624949_at:540:513; Interrogation_Position=625; Antisense; GTGTTCGGGTGAATGCGGTCAATCC
>probe:Drosophila_2:1624949_at:214:233; Interrogation_Position=645; Antisense; AATCCGGGTGTGATTCGCACCAATC
>probe:Drosophila_2:1624949_at:545:417; Interrogation_Position=698; Antisense; GAGCTACGCCGAATTTCTGGAGCAC
>probe:Drosophila_2:1624949_at:80:579; Interrogation_Position=823; Antisense; TGACCCTTCCTGTGGACGGTGGCAA
>probe:Drosophila_2:1624949_at:272:209; Interrogation_Position=846; Antisense; AAGCAGGTCATGTGTCCGCGCTAGT
>probe:Drosophila_2:1624949_at:158:299; Interrogation_Position=862; Antisense; CGCGCTAGTCTCTGCTAGGATATTC
>probe:Drosophila_2:1624949_at:325:449; Interrogation_Position=900; Antisense; GATCCTGTCCAGACGAATGTCTTTA
>probe:Drosophila_2:1624949_at:568:693; Interrogation_Position=937; Antisense; TTTCCGCCGATTAAGTCCATTACTA
>probe:Drosophila_2:1624949_at:623:709; Interrogation_Position=988; Antisense; TTAAATCTTGCGTACGTTGCCAATT

Paste this into a BLAST search page for me
TTCACCCACGTGATGGAGGCCAATGCAATGTGCGTTCTGGGTTTTATCTGTGCTGCCCCAGTTGCTGCAGTGTAAAGGGCAGCATTGTCAACGTGTCCAGCTACAACATGTCCAAGGCGGCGGTGGTGTTCGGGTGAATGCGGTCAATCCAATCCGGGTGTGATTCGCACCAATCGAGCTACGCCGAATTTCTGGAGCACTGACCCTTCCTGTGGACGGTGGCAAAAGCAGGTCATGTGTCCGCGCTAGTCGCGCTAGTCTCTGCTAGGATATTCGATCCTGTCCAGACGAATGTCTTTATTTCCGCCGATTAAGTCCATTACTATTAAATCTTGCGTACGTTGCCAATT

Full Affymetrix probeset data:

Annotations for 1624949_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720