FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624951_at:

>probe:Drosophila_2:1624951_at:400:73; Interrogation_Position=124; Antisense; AGGAAGCTCCGGCTAAAGCCACGTG
>probe:Drosophila_2:1624951_at:333:173; Interrogation_Position=138; Antisense; AAAGCCACGTGTCTACCCAGGGCAT
>probe:Drosophila_2:1624951_at:685:605; Interrogation_Position=14; Antisense; TGATGCTCGGAGTGGCACTGAGCTT
>probe:Drosophila_2:1624951_at:726:293; Interrogation_Position=164; Antisense; CCTCTCAGGCTTGCGGAAACGTGGA
>probe:Drosophila_2:1624951_at:62:177; Interrogation_Position=180; Antisense; AAACGTGGAGGCGACGGATCATGCC
>probe:Drosophila_2:1624951_at:198:125; Interrogation_Position=239; Antisense; AGCCGCGTCGCATTTACAATCACCA
>probe:Drosophila_2:1624951_at:437:519; Interrogation_Position=274; Antisense; GTGGACAGCTCGTTCTTTGAGCCCA
>probe:Drosophila_2:1624951_at:309:257; Interrogation_Position=29; Antisense; CACTGAGCTTGGTTTGGGCCGGCCC
>probe:Drosophila_2:1624951_at:486:133; Interrogation_Position=298; Antisense; ACGCCGGATCGGATCGAGGAACTCA
>probe:Drosophila_2:1624951_at:705:561; Interrogation_Position=315; Antisense; GGAACTCAAGCGTATTCTCTTGGAT
>probe:Drosophila_2:1624951_at:23:329; Interrogation_Position=324; Antisense; GCGTATTCTCTTGGATCAGCAATGA
>probe:Drosophila_2:1624951_at:199:445; Interrogation_Position=55; Antisense; GATGATGGCTACCTTTATGACCAGC
>probe:Drosophila_2:1624951_at:279:681; Interrogation_Position=70; Antisense; TATGACCAGCCATCGGGTGAGCAAC
>probe:Drosophila_2:1624951_at:550:713; Interrogation_Position=95; Antisense; TTCAGGAACTCCAGGTGATCTCTCC

Paste this into a BLAST search page for me
AGGAAGCTCCGGCTAAAGCCACGTGAAAGCCACGTGTCTACCCAGGGCATTGATGCTCGGAGTGGCACTGAGCTTCCTCTCAGGCTTGCGGAAACGTGGAAAACGTGGAGGCGACGGATCATGCCAGCCGCGTCGCATTTACAATCACCAGTGGACAGCTCGTTCTTTGAGCCCACACTGAGCTTGGTTTGGGCCGGCCCACGCCGGATCGGATCGAGGAACTCAGGAACTCAAGCGTATTCTCTTGGATGCGTATTCTCTTGGATCAGCAATGAGATGATGGCTACCTTTATGACCAGCTATGACCAGCCATCGGGTGAGCAACTTCAGGAACTCCAGGTGATCTCTCC

Full Affymetrix probeset data:

Annotations for 1624951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720