Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624952_at:

>probe:Drosophila_2:1624952_at:128:685; Interrogation_Position=1045; Antisense; TATCCTGGTGCAGCTGCTATTTCAA
>probe:Drosophila_2:1624952_at:167:97; Interrogation_Position=1084; Antisense; AGATCACCAGTTGACATCGGGCAAA
>probe:Drosophila_2:1624952_at:653:525; Interrogation_Position=1132; Antisense; GGGACCCATCACTCACATGGATTGA
>probe:Drosophila_2:1624952_at:29:147; Interrogation_Position=567; Antisense; ACTTTATAAGGGTTCGTCTGCGTCT
>probe:Drosophila_2:1624952_at:228:231; Interrogation_Position=670; Antisense; AATGTCCAAGCGCTGTTCGTTTCTC
>probe:Drosophila_2:1624952_at:237:429; Interrogation_Position=711; Antisense; GAGTTTTTGGATTCGCCGCAGCTGC
>probe:Drosophila_2:1624952_at:249:461; Interrogation_Position=749; Antisense; GATTTCACTATCATGACCTGCTTCG
>probe:Drosophila_2:1624952_at:566:343; Interrogation_Position=768; Antisense; GCTTCGTGTACGTTATCTGCCAAAA
>probe:Drosophila_2:1624952_at:190:285; Interrogation_Position=811; Antisense; CTGGGATCCCGAGTACGTGTACATG
>probe:Drosophila_2:1624952_at:161:491; Interrogation_Position=829; Antisense; GTACATGTTGCTGCACGTGGCCATA
>probe:Drosophila_2:1624952_at:225:519; Interrogation_Position=866; Antisense; GTGGTCATTACTAGCACCTATGGGT
>probe:Drosophila_2:1624952_at:367:547; Interrogation_Position=928; Antisense; GGAGGACTTTCAGCATTGGCGCATG
>probe:Drosophila_2:1624952_at:350:65; Interrogation_Position=971; Antisense; ATGGTGGGCAGCACAACCTTGCTAA
>probe:Drosophila_2:1624952_at:718:337; Interrogation_Position=991; Antisense; GCTAAGTGTTTCTACCATTTACCTG

Paste this into a BLAST search page for me
TATCCTGGTGCAGCTGCTATTTCAAAGATCACCAGTTGACATCGGGCAAAGGGACCCATCACTCACATGGATTGAACTTTATAAGGGTTCGTCTGCGTCTAATGTCCAAGCGCTGTTCGTTTCTCGAGTTTTTGGATTCGCCGCAGCTGCGATTTCACTATCATGACCTGCTTCGGCTTCGTGTACGTTATCTGCCAAAACTGGGATCCCGAGTACGTGTACATGGTACATGTTGCTGCACGTGGCCATAGTGGTCATTACTAGCACCTATGGGTGGAGGACTTTCAGCATTGGCGCATGATGGTGGGCAGCACAACCTTGCTAAGCTAAGTGTTTCTACCATTTACCTG

Full Affymetrix probeset data:

Annotations for 1624952_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime