FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624953_at:

>probe:Drosophila_2:1624953_at:509:111; Interrogation_Position=1101; Antisense; AGCAAACTAACTTCGCTTCATAGCG
>probe:Drosophila_2:1624953_at:705:21; Interrogation_Position=1141; Antisense; ATATGAAATCCCTTCCGTATCTCAG
>probe:Drosophila_2:1624953_at:679:235; Interrogation_Position=1180; Antisense; AATCGCTTCGATTGTATCCAGTCAC
>probe:Drosophila_2:1624953_at:597:449; Interrogation_Position=1219; Antisense; GATCCGCCGGAGCTGATGTTGTCCT
>probe:Drosophila_2:1624953_at:472:59; Interrogation_Position=1234; Antisense; ATGTTGTCCTCGATGGCTACCGAAT
>probe:Drosophila_2:1624953_at:205:83; Interrogation_Position=1264; Antisense; AGGGCACCAAGCTTCTGATGACCAA
>probe:Drosophila_2:1624953_at:48:443; Interrogation_Position=1280; Antisense; GATGACCAACAGCTTTTTGCTTAAG
>probe:Drosophila_2:1624953_at:451:691; Interrogation_Position=1295; Antisense; TTTGCTTAAGGACGACCGACTGTAT
>probe:Drosophila_2:1624953_at:22:169; Interrogation_Position=1328; Antisense; AAAGGAATTCATCCCGGAACGCTGG
>probe:Drosophila_2:1624953_at:43:167; Interrogation_Position=1403; Antisense; AAATGCCTTTATCTACTTGCCGTTC
>probe:Drosophila_2:1624953_at:567:715; Interrogation_Position=1425; Antisense; TTCGGATTCGGACCACGCATGTGTG
>probe:Drosophila_2:1624953_at:46:67; Interrogation_Position=1476; Antisense; ATGGAACTCACGGTTGCCAACTTGG
>probe:Drosophila_2:1624953_at:500:217; Interrogation_Position=1548; Antisense; AAGTGCAGGTTTTTGTACAAGCCCA
>probe:Drosophila_2:1624953_at:593:489; Interrogation_Position=1562; Antisense; GTACAAGCCCAATATTCCTCTGAAA

Paste this into a BLAST search page for me
AGCAAACTAACTTCGCTTCATAGCGATATGAAATCCCTTCCGTATCTCAGAATCGCTTCGATTGTATCCAGTCACGATCCGCCGGAGCTGATGTTGTCCTATGTTGTCCTCGATGGCTACCGAATAGGGCACCAAGCTTCTGATGACCAAGATGACCAACAGCTTTTTGCTTAAGTTTGCTTAAGGACGACCGACTGTATAAAGGAATTCATCCCGGAACGCTGGAAATGCCTTTATCTACTTGCCGTTCTTCGGATTCGGACCACGCATGTGTGATGGAACTCACGGTTGCCAACTTGGAAGTGCAGGTTTTTGTACAAGCCCAGTACAAGCCCAATATTCCTCTGAAA

Full Affymetrix probeset data:

Annotations for 1624953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720