Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624956_at:

>probe:Drosophila_2:1624956_at:435:323; Interrogation_Position=3839; Antisense; GCGCCGCGCTGGGAAGCTATATTAT
>probe:Drosophila_2:1624956_at:657:375; Interrogation_Position=3851; Antisense; GAAGCTATATTATCGCGACTCGGGC
>probe:Drosophila_2:1624956_at:299:299; Interrogation_Position=3864; Antisense; CGCGACTCGGGCTTAAATTTTGGTG
>probe:Drosophila_2:1624956_at:525:689; Interrogation_Position=3882; Antisense; TTTGGTGGAACCATCATGCCGGTCA
>probe:Drosophila_2:1624956_at:310:49; Interrogation_Position=3897; Antisense; ATGCCGGTCATATGTTTTTGTTTCT
>probe:Drosophila_2:1624956_at:520:729; Interrogation_Position=3921; Antisense; TTGGCTTTCTTGGACTTGCCGGCAC
>probe:Drosophila_2:1624956_at:636:719; Interrogation_Position=3936; Antisense; TTGCCGGCACCCGACTGAAAGTCAT
>probe:Drosophila_2:1624956_at:454:171; Interrogation_Position=3953; Antisense; AAAGTCATGCCAGCTGTTTACTCGG
>probe:Drosophila_2:1624956_at:114:405; Interrogation_Position=3987; Antisense; GACTCTTCGAAGTTCTGCTGCCATT
>probe:Drosophila_2:1624956_at:309:337; Interrogation_Position=4108; Antisense; GCTCCATGTCGGCAAACAGTTTCAT
>probe:Drosophila_2:1624956_at:498:271; Interrogation_Position=4136; Antisense; CATAACGTAGATGGCGTGCTTGTAC
>probe:Drosophila_2:1624956_at:179:603; Interrogation_Position=4152; Antisense; TGCTTGTACTTGGTGGGATCGTCCT
>probe:Drosophila_2:1624956_at:538:41; Interrogation_Position=4169; Antisense; ATCGTCCTCGGGTATTGGCTCAGTG
>probe:Drosophila_2:1624956_at:84:343; Interrogation_Position=4213; Antisense; GCTTTTTACGCTTTTCTGCAATCTG

Paste this into a BLAST search page for me
GCGCCGCGCTGGGAAGCTATATTATGAAGCTATATTATCGCGACTCGGGCCGCGACTCGGGCTTAAATTTTGGTGTTTGGTGGAACCATCATGCCGGTCAATGCCGGTCATATGTTTTTGTTTCTTTGGCTTTCTTGGACTTGCCGGCACTTGCCGGCACCCGACTGAAAGTCATAAAGTCATGCCAGCTGTTTACTCGGGACTCTTCGAAGTTCTGCTGCCATTGCTCCATGTCGGCAAACAGTTTCATCATAACGTAGATGGCGTGCTTGTACTGCTTGTACTTGGTGGGATCGTCCTATCGTCCTCGGGTATTGGCTCAGTGGCTTTTTACGCTTTTCTGCAATCTG

Full Affymetrix probeset data:

Annotations for 1624956_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime