Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624960_at:

>probe:Drosophila_2:1624960_at:352:219; Interrogation_Position=104; Antisense; AAGTCGCTTCGTTTGGCTTCGCTGA
>probe:Drosophila_2:1624960_at:475:275; Interrogation_Position=110; Antisense; CTTCGTTTGGCTTCGCTGACAGCGG
>probe:Drosophila_2:1624960_at:106:613; Interrogation_Position=126; Antisense; TGACAGCGGCTCGTGCCAGTACTCA
>probe:Drosophila_2:1624960_at:677:505; Interrogation_Position=138; Antisense; GTGCCAGTACTCAACCGACTGCCAA
>probe:Drosophila_2:1624960_at:55:487; Interrogation_Position=144; Antisense; GTACTCAACCGACTGCCAAACGGCG
>probe:Drosophila_2:1624960_at:688:177; Interrogation_Position=161; Antisense; AAACGGCGCACGACAAACCAGCAGC
>probe:Drosophila_2:1624960_at:482:181; Interrogation_Position=17; Antisense; AAAAAGCAAACTTTCTCGCTGCCGG
>probe:Drosophila_2:1624960_at:721:209; Interrogation_Position=20; Antisense; AAGCAAACTTTCTCGCTGCCGGCGT
>probe:Drosophila_2:1624960_at:484:187; Interrogation_Position=228; Antisense; AACACGACGCCAGCAGCAGTAACAG
>probe:Drosophila_2:1624960_at:535:319; Interrogation_Position=252; Antisense; GCCGCACGGCAGAAACAGCAACACT
>probe:Drosophila_2:1624960_at:154:351; Interrogation_Position=255; Antisense; GCACGGCAGAAACAGCAACACTAGC
>probe:Drosophila_2:1624960_at:650:635; Interrogation_Position=44; Antisense; TCGCAGCTGGCGTCGTGTTGCTGCT
>probe:Drosophila_2:1624960_at:562:327; Interrogation_Position=85; Antisense; GCGTCGCTCGCGTCGCTCGAAGTCG
>probe:Drosophila_2:1624960_at:624:327; Interrogation_Position=94; Antisense; GCGTCGCTCGAAGTCGCTTCGTTTG

Paste this into a BLAST search page for me
AAGTCGCTTCGTTTGGCTTCGCTGACTTCGTTTGGCTTCGCTGACAGCGGTGACAGCGGCTCGTGCCAGTACTCAGTGCCAGTACTCAACCGACTGCCAAGTACTCAACCGACTGCCAAACGGCGAAACGGCGCACGACAAACCAGCAGCAAAAAGCAAACTTTCTCGCTGCCGGAAGCAAACTTTCTCGCTGCCGGCGTAACACGACGCCAGCAGCAGTAACAGGCCGCACGGCAGAAACAGCAACACTGCACGGCAGAAACAGCAACACTAGCTCGCAGCTGGCGTCGTGTTGCTGCTGCGTCGCTCGCGTCGCTCGAAGTCGGCGTCGCTCGAAGTCGCTTCGTTTG

Full Affymetrix probeset data:

Annotations for 1624960_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime