FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624961_at:

>probe:Drosophila_2:1624961_at:109:225; Interrogation_Position=472; Antisense; AAGGAGTTCTATTCGGTTCCACTGG
>probe:Drosophila_2:1624961_at:715:469; Interrogation_Position=487; Antisense; GTTCCACTGGCTCGACGTCTTATAG
>probe:Drosophila_2:1624961_at:566:495; Interrogation_Position=503; Antisense; GTCTTATAGCCGACGAGTTTGCCGA
>probe:Drosophila_2:1624961_at:587:429; Interrogation_Position=517; Antisense; GAGTTTGCCGAGTTGACCAGTTCAG
>probe:Drosophila_2:1624961_at:27:389; Interrogation_Position=592; Antisense; GAAAACAATCAACTCGACGGCGAAG
>probe:Drosophila_2:1624961_at:468:97; Interrogation_Position=678; Antisense; AGATCATTCTGAGCCTGAACCAGGT
>probe:Drosophila_2:1624961_at:97:195; Interrogation_Position=731; Antisense; AACTGAAGGCCGAGCTCTTTAGCAA
>probe:Drosophila_2:1624961_at:70:107; Interrogation_Position=768; Antisense; AGAATTGGCCTCTTTAACGCACTTG
>probe:Drosophila_2:1624961_at:86:619; Interrogation_Position=791; Antisense; TGCATCGAATGCCATCGGTCAACGA
>probe:Drosophila_2:1624961_at:624:443; Interrogation_Position=814; Antisense; GATGATGAACCAAGTCGCGAGCCTC
>probe:Drosophila_2:1624961_at:197:1; Interrogation_Position=906; Antisense; AATAACGTCCGAGAAGCCTACTCCT
>probe:Drosophila_2:1624961_at:493:315; Interrogation_Position=921; Antisense; GCCTACTCCTGCTCGTATATGTAAA
>probe:Drosophila_2:1624961_at:70:161; Interrogation_Position=943; Antisense; AAATCCAACCCTGATAATCGTCCTG
>probe:Drosophila_2:1624961_at:653:223; Interrogation_Position=958; Antisense; AATCGTCCTGGCACTTCTAAGAAAG

Paste this into a BLAST search page for me
AAGGAGTTCTATTCGGTTCCACTGGGTTCCACTGGCTCGACGTCTTATAGGTCTTATAGCCGACGAGTTTGCCGAGAGTTTGCCGAGTTGACCAGTTCAGGAAAACAATCAACTCGACGGCGAAGAGATCATTCTGAGCCTGAACCAGGTAACTGAAGGCCGAGCTCTTTAGCAAAGAATTGGCCTCTTTAACGCACTTGTGCATCGAATGCCATCGGTCAACGAGATGATGAACCAAGTCGCGAGCCTCAATAACGTCCGAGAAGCCTACTCCTGCCTACTCCTGCTCGTATATGTAAAAAATCCAACCCTGATAATCGTCCTGAATCGTCCTGGCACTTCTAAGAAAG

Full Affymetrix probeset data:

Annotations for 1624961_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720