FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624962_at:

>probe:Drosophila_2:1624962_at:21:349; Interrogation_Position=1035; Antisense; GCAGGATATCAACGCTCAACTCCAG
>probe:Drosophila_2:1624962_at:248:587; Interrogation_Position=1061; Antisense; TGGAGCCCAGTGTTTTCACCAAACA
>probe:Drosophila_2:1624962_at:110:145; Interrogation_Position=1146; Antisense; ACTGCTGCCACTGAATGCGGGTAAC
>probe:Drosophila_2:1624962_at:165:491; Interrogation_Position=1166; Antisense; GTAACAACAATTCATCGACCACCAC
>probe:Drosophila_2:1624962_at:335:67; Interrogation_Position=1253; Antisense; ATGGCAAAGTGACAGCTCCGCCGGA
>probe:Drosophila_2:1624962_at:495:337; Interrogation_Position=1267; Antisense; GCTCCGCCGGAGAATTTGATTATAT
>probe:Drosophila_2:1624962_at:166:345; Interrogation_Position=1312; Antisense; GCATTTTGCACCACCGCGAGAAGAG
>probe:Drosophila_2:1624962_at:18:71; Interrogation_Position=769; Antisense; AGGAAACTGCGATCGGTGGGTCCCA
>probe:Drosophila_2:1624962_at:418:63; Interrogation_Position=836; Antisense; AGGTCACTCGACTGGTACTGACGGT
>probe:Drosophila_2:1624962_at:459:603; Interrogation_Position=854; Antisense; TGACGGTGGCCCTGATTCACTCGAA
>probe:Drosophila_2:1624962_at:104:163; Interrogation_Position=908; Antisense; AAATACTCATTTTCCTACTTCTGGG
>probe:Drosophila_2:1624962_at:716:563; Interrogation_Position=933; Antisense; GGCACTGGTTTACTCGAATTCGGCG
>probe:Drosophila_2:1624962_at:667:637; Interrogation_Position=952; Antisense; TCGGCGGTGAATCCCATACTTTATG
>probe:Drosophila_2:1624962_at:547:373; Interrogation_Position=999; Antisense; GAAGAGCTTCTTCAAGGCCTTTACC

Paste this into a BLAST search page for me
GCAGGATATCAACGCTCAACTCCAGTGGAGCCCAGTGTTTTCACCAAACAACTGCTGCCACTGAATGCGGGTAACGTAACAACAATTCATCGACCACCACATGGCAAAGTGACAGCTCCGCCGGAGCTCCGCCGGAGAATTTGATTATATGCATTTTGCACCACCGCGAGAAGAGAGGAAACTGCGATCGGTGGGTCCCAAGGTCACTCGACTGGTACTGACGGTTGACGGTGGCCCTGATTCACTCGAAAAATACTCATTTTCCTACTTCTGGGGGCACTGGTTTACTCGAATTCGGCGTCGGCGGTGAATCCCATACTTTATGGAAGAGCTTCTTCAAGGCCTTTACC

Full Affymetrix probeset data:

Annotations for 1624962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720