FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624963_at:

>probe:Drosophila_2:1624963_at:657:325; Interrogation_Position=1117; Antisense; GCGACGAGCGTTTTGTGCACAGTAC
>probe:Drosophila_2:1624963_at:241:617; Interrogation_Position=1132; Antisense; TGCACAGTACTATGCGATCGCGCCA
>probe:Drosophila_2:1624963_at:50:451; Interrogation_Position=1147; Antisense; GATCGCGCCACGAAAACCGGGTACA
>probe:Drosophila_2:1624963_at:109:137; Interrogation_Position=1225; Antisense; ACGAGTCGAACTACCAGAGGGCCAA
>probe:Drosophila_2:1624963_at:520:81; Interrogation_Position=1242; Antisense; AGGGCCAAGCACGAGGTGGTCCACA
>probe:Drosophila_2:1624963_at:335:325; Interrogation_Position=1270; Antisense; GCGAGCGTAACTTCCACTGTGAGGT
>probe:Drosophila_2:1624963_at:82:511; Interrogation_Position=1288; Antisense; GTGAGGTCTGCAAAGTGTCCTTTAC
>probe:Drosophila_2:1624963_at:563:515; Interrogation_Position=1302; Antisense; GTGTCCTTTACACGGAACTCGAACT
>probe:Drosophila_2:1624963_at:49:563; Interrogation_Position=1315; Antisense; GGAACTCGAACTTGAAGACCCACTA
>probe:Drosophila_2:1624963_at:38:673; Interrogation_Position=1338; Antisense; TACCGCTCCAGGCAGCATCAAAATA
>probe:Drosophila_2:1624963_at:221:297; Interrogation_Position=1370; Antisense; CGCAATGAGTGCTAAGTCCGAAATT
>probe:Drosophila_2:1624963_at:388:467; Interrogation_Position=1437; Antisense; GTTGTCATCCGTTTAGAGGTCTAAT
>probe:Drosophila_2:1624963_at:613:435; Interrogation_Position=1452; Antisense; GAGGTCTAATGTTCTTATCTGTTAA
>probe:Drosophila_2:1624963_at:41:395; Interrogation_Position=1573; Antisense; GAAAGTGGATCTTTCATCCTCTTAA

Paste this into a BLAST search page for me
GCGACGAGCGTTTTGTGCACAGTACTGCACAGTACTATGCGATCGCGCCAGATCGCGCCACGAAAACCGGGTACAACGAGTCGAACTACCAGAGGGCCAAAGGGCCAAGCACGAGGTGGTCCACAGCGAGCGTAACTTCCACTGTGAGGTGTGAGGTCTGCAAAGTGTCCTTTACGTGTCCTTTACACGGAACTCGAACTGGAACTCGAACTTGAAGACCCACTATACCGCTCCAGGCAGCATCAAAATACGCAATGAGTGCTAAGTCCGAAATTGTTGTCATCCGTTTAGAGGTCTAATGAGGTCTAATGTTCTTATCTGTTAAGAAAGTGGATCTTTCATCCTCTTAA

Full Affymetrix probeset data:

Annotations for 1624963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720