FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624964_at:

>probe:Drosophila_2:1624964_at:606:155; Interrogation_Position=105; Antisense; ACACGGTGGACTCAGTGGCTTGGGA
>probe:Drosophila_2:1624964_at:687:399; Interrogation_Position=121; Antisense; GGCTTGGGAGGACTTGGCGGCTTAG
>probe:Drosophila_2:1624964_at:132:613; Interrogation_Position=14; Antisense; TGAAATTATATGCACTCTGCGCTAT
>probe:Drosophila_2:1624964_at:16:579; Interrogation_Position=210; Antisense; TGGCTACGGCGGACCCGGTAGCTAC
>probe:Drosophila_2:1624964_at:652:89; Interrogation_Position=255; Antisense; AGTAGCCACTGCCAACGCTAATGCA
>probe:Drosophila_2:1624964_at:285:145; Interrogation_Position=262; Antisense; ACTGCCAACGCTAATGCAAACGCAA
>probe:Drosophila_2:1624964_at:364:231; Interrogation_Position=274; Antisense; AATGCAAACGCAAACTCAGTTGGTT
>probe:Drosophila_2:1624964_at:138:193; Interrogation_Position=286; Antisense; AACTCAGTTGGTTACAGTCCGGGTG
>probe:Drosophila_2:1624964_at:36:39; Interrogation_Position=292; Antisense; GTTGGTTACAGTCCGGGTGCTTACT
>probe:Drosophila_2:1624964_at:311:267; Interrogation_Position=300; Antisense; CAGTCCGGGTGCTTACTACGGATAA
>probe:Drosophila_2:1624964_at:375:337; Interrogation_Position=42; Antisense; GCTCCTTGCCATTGTGGCAGTCCAA
>probe:Drosophila_2:1624964_at:457:595; Interrogation_Position=54; Antisense; TGTGGCAGTCCAAGGATATCCTGGT
>probe:Drosophila_2:1624964_at:347:451; Interrogation_Position=68; Antisense; GATATCCTGGTATACACGGTGGCTT
>probe:Drosophila_2:1624964_at:66:29; Interrogation_Position=79; Antisense; ATACACGGTGGCTTTGGACACGGAG

Paste this into a BLAST search page for me
ACACGGTGGACTCAGTGGCTTGGGAGGCTTGGGAGGACTTGGCGGCTTAGTGAAATTATATGCACTCTGCGCTATTGGCTACGGCGGACCCGGTAGCTACAGTAGCCACTGCCAACGCTAATGCAACTGCCAACGCTAATGCAAACGCAAAATGCAAACGCAAACTCAGTTGGTTAACTCAGTTGGTTACAGTCCGGGTGGTTGGTTACAGTCCGGGTGCTTACTCAGTCCGGGTGCTTACTACGGATAAGCTCCTTGCCATTGTGGCAGTCCAATGTGGCAGTCCAAGGATATCCTGGTGATATCCTGGTATACACGGTGGCTTATACACGGTGGCTTTGGACACGGAG

Full Affymetrix probeset data:

Annotations for 1624964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720