Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624967_at:

>probe:Drosophila_2:1624967_at:706:443; Interrogation_Position=1668; Antisense; GATGAAGGACCACTGCTACTGGCCA
>probe:Drosophila_2:1624967_at:589:575; Interrogation_Position=1687; Antisense; TGGCCACTAGTCTCGGACTTTAACA
>probe:Drosophila_2:1624967_at:543:195; Interrogation_Position=1711; Antisense; AACGTCCTTTCACACGAATCGGTGG
>probe:Drosophila_2:1624967_at:252:715; Interrogation_Position=1745; Antisense; TTCTGCGGGACGACAATCTCATCGA
>probe:Drosophila_2:1624967_at:710:457; Interrogation_Position=1768; Antisense; GATATGTGGTTCCAGTTTCTCCAGA
>probe:Drosophila_2:1624967_at:252:105; Interrogation_Position=1823; Antisense; AGACGGCTTCTCATGTGGAATTCGA
>probe:Drosophila_2:1624967_at:524:163; Interrogation_Position=1851; Antisense; AAATAGCTACTATGCGGCGTTCTCC
>probe:Drosophila_2:1624967_at:289:87; Interrogation_Position=1891; Antisense; AGTGCCTATCCCATGTGGTCGATTA
>probe:Drosophila_2:1624967_at:572:535; Interrogation_Position=1907; Antisense; GGTCGATTATCTCGCATCTGCAGGA
>probe:Drosophila_2:1624967_at:86:669; Interrogation_Position=1969; Antisense; TACTGTGTGACGACGCTGCACGAGT
>probe:Drosophila_2:1624967_at:351:703; Interrogation_Position=2012; Antisense; TTATGGAGGCGCGTCTATCTATGGA
>probe:Drosophila_2:1624967_at:290:99; Interrogation_Position=2039; Antisense; AGATGATGCAGGCTTCGTTCCACTT
>probe:Drosophila_2:1624967_at:687:35; Interrogation_Position=2119; Antisense; ATCAGTCTGAACGATGTGCTGCCCT
>probe:Drosophila_2:1624967_at:301:149; Interrogation_Position=2181; Antisense; ACTTCGCGTCCAGGTAGTGTACAAC

Paste this into a BLAST search page for me
GATGAAGGACCACTGCTACTGGCCATGGCCACTAGTCTCGGACTTTAACAAACGTCCTTTCACACGAATCGGTGGTTCTGCGGGACGACAATCTCATCGAGATATGTGGTTCCAGTTTCTCCAGAAGACGGCTTCTCATGTGGAATTCGAAAATAGCTACTATGCGGCGTTCTCCAGTGCCTATCCCATGTGGTCGATTAGGTCGATTATCTCGCATCTGCAGGATACTGTGTGACGACGCTGCACGAGTTTATGGAGGCGCGTCTATCTATGGAAGATGATGCAGGCTTCGTTCCACTTATCAGTCTGAACGATGTGCTGCCCTACTTCGCGTCCAGGTAGTGTACAAC

Full Affymetrix probeset data:

Annotations for 1624967_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime