FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624968_at:

>probe:Drosophila_2:1624968_at:607:491; Interrogation_Position=1004; Antisense; GTAACAATCTAACCGGTGCTACCAA
>probe:Drosophila_2:1624968_at:377:219; Interrogation_Position=1026; Antisense; CAATTCGCCGGACACTAACTATTTT
>probe:Drosophila_2:1624968_at:139:49; Interrogation_Position=498; Antisense; ATGCCGTTGGCCTGGTTGCGAAATG
>probe:Drosophila_2:1624968_at:519:409; Interrogation_Position=577; Antisense; GACGATCGATCAACAGCACAGGCAC
>probe:Drosophila_2:1624968_at:615:167; Interrogation_Position=608; Antisense; AAATGCAAGTTGTCTCCCAGCTGGA
>probe:Drosophila_2:1624968_at:390:333; Interrogation_Position=627; Antisense; GCTGGAATCCCACCTGCAAAAAGAA
>probe:Drosophila_2:1624968_at:720:381; Interrogation_Position=649; Antisense; GAACGAGATCGCTTGCAGGCAATGA
>probe:Drosophila_2:1624968_at:211:59; Interrogation_Position=670; Antisense; ATGATGCATCACTTGTATTTGTCCA
>probe:Drosophila_2:1624968_at:643:691; Interrogation_Position=702; Antisense; TTTGTCTCCCACCAAAATCGACAGG
>probe:Drosophila_2:1624968_at:364:245; Interrogation_Position=780; Antisense; AATTGACTCCCCTGACAAGCAGTTA
>probe:Drosophila_2:1624968_at:231:179; Interrogation_Position=833; Antisense; AAAACACATTTTGCTACTTCCGGCG
>probe:Drosophila_2:1624968_at:551:563; Interrogation_Position=872; Antisense; GGAAGAACGCAGTCCGGCACAATCT
>probe:Drosophila_2:1624968_at:99:237; Interrogation_Position=892; Antisense; AATCTGTCCCTTCATAAGTGCTTTA
>probe:Drosophila_2:1624968_at:632:261; Interrogation_Position=985; Antisense; CAGCGCACTGCTGGCATTGGTAACA

Paste this into a BLAST search page for me
GTAACAATCTAACCGGTGCTACCAACAATTCGCCGGACACTAACTATTTTATGCCGTTGGCCTGGTTGCGAAATGGACGATCGATCAACAGCACAGGCACAAATGCAAGTTGTCTCCCAGCTGGAGCTGGAATCCCACCTGCAAAAAGAAGAACGAGATCGCTTGCAGGCAATGAATGATGCATCACTTGTATTTGTCCATTTGTCTCCCACCAAAATCGACAGGAATTGACTCCCCTGACAAGCAGTTAAAAACACATTTTGCTACTTCCGGCGGGAAGAACGCAGTCCGGCACAATCTAATCTGTCCCTTCATAAGTGCTTTACAGCGCACTGCTGGCATTGGTAACA

Full Affymetrix probeset data:

Annotations for 1624968_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720