Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624969_s_at:

>probe:Drosophila_2:1624969_s_at:35:255; Interrogation_Position=399; Antisense; CAACGAGGTGGTCATTGAGCTCAGC
>probe:Drosophila_2:1624969_s_at:131:609; Interrogation_Position=414; Antisense; TGAGCTCAGCGAGGACGAGTCGTCC
>probe:Drosophila_2:1624969_s_at:482:561; Interrogation_Position=479; Antisense; GGAACATCCGGCGATTCTTTGCGGA
>probe:Drosophila_2:1624969_s_at:87:621; Interrogation_Position=494; Antisense; TCTTTGCGGAGGTGGGCGACAACCA
>probe:Drosophila_2:1624969_s_at:466:119; Interrogation_Position=521; Antisense; AGCTGCGCACGAACACCATTGAGAA
>probe:Drosophila_2:1624969_s_at:473:723; Interrogation_Position=539; Antisense; TTGAGAACATGCTGATGGCCCTGCC
>probe:Drosophila_2:1624969_s_at:381:221; Interrogation_Position=580; Antisense; AAGTGAGGAGCCGTTCACCCAGCTA
>probe:Drosophila_2:1624969_s_at:484:659; Interrogation_Position=603; Antisense; TAACCGGCTTATCCCTGGCAGCAGA
>probe:Drosophila_2:1624969_s_at:100:115; Interrogation_Position=622; Antisense; AGCAGAAGCTGTCGCATCCCTACAC
>probe:Drosophila_2:1624969_s_at:374:45; Interrogation_Position=637; Antisense; ATCCCTACACCTGCACTGAGAAAAA
>probe:Drosophila_2:1624969_s_at:120:707; Interrogation_Position=873; Antisense; TTAGATGAAGCTTTTCCCCTGTGTA
>probe:Drosophila_2:1624969_s_at:585:377; Interrogation_Position=886; Antisense; TTCCCCTGTGTAGAGTTCCCTAACT
>probe:Drosophila_2:1624969_s_at:278:471; Interrogation_Position=900; Antisense; GTTCCCTAACTCTTTCATACTTGTA
>probe:Drosophila_2:1624969_s_at:682:17; Interrogation_Position=938; Antisense; ATTTCGTGTCTGTTTTTGTCGCTTT

Paste this into a BLAST search page for me
CAACGAGGTGGTCATTGAGCTCAGCTGAGCTCAGCGAGGACGAGTCGTCCGGAACATCCGGCGATTCTTTGCGGATCTTTGCGGAGGTGGGCGACAACCAAGCTGCGCACGAACACCATTGAGAATTGAGAACATGCTGATGGCCCTGCCAAGTGAGGAGCCGTTCACCCAGCTATAACCGGCTTATCCCTGGCAGCAGAAGCAGAAGCTGTCGCATCCCTACACATCCCTACACCTGCACTGAGAAAAATTAGATGAAGCTTTTCCCCTGTGTATTCCCCTGTGTAGAGTTCCCTAACTGTTCCCTAACTCTTTCATACTTGTAATTTCGTGTCTGTTTTTGTCGCTTT

Full Affymetrix probeset data:

Annotations for 1624969_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime