FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624971_at:

>probe:Drosophila_2:1624971_at:506:419; Interrogation_Position=1020; Antisense; GAGCTATTCTGCTGCTGGTCTTCGA
>probe:Drosophila_2:1624971_at:353:591; Interrogation_Position=1035; Antisense; TGGTCTTCGAGTACTCCTACGATTA
>probe:Drosophila_2:1624971_at:654:661; Interrogation_Position=1073; Antisense; TACTCCTAGTCCTTAAGTCCTCAAG
>probe:Drosophila_2:1624971_at:127:99; Interrogation_Position=1096; Antisense; AGAGGCAAGCGCCTTCTTTGTTTTT
>probe:Drosophila_2:1624971_at:647:461; Interrogation_Position=1138; Antisense; GATTAGTCGCGATCAATGCCATCAA
>probe:Drosophila_2:1624971_at:137:447; Interrogation_Position=1166; Antisense; GATGCTACTCTTCCGATTGTGATTC
>probe:Drosophila_2:1624971_at:325:709; Interrogation_Position=722; Antisense; TTCAACATGGTGTACTTCGGGTTCT
>probe:Drosophila_2:1624971_at:155:715; Interrogation_Position=737; Antisense; TTCGGGTTCTACCACAGCGTGAAGA
>probe:Drosophila_2:1624971_at:243:511; Interrogation_Position=755; Antisense; GTGAAGAACGTGGTGCCCGAGTACA
>probe:Drosophila_2:1624971_at:246:549; Interrogation_Position=793; Antisense; GGAGTTTCTGCGCAAGGTGACCATC
>probe:Drosophila_2:1624971_at:238:65; Interrogation_Position=938; Antisense; ATGGGCATCGTCTACCGCGAGGAAG
>probe:Drosophila_2:1624971_at:516:563; Interrogation_Position=958; Antisense; GGAAGGATTCCGAGCGCTGTACAAA
>probe:Drosophila_2:1624971_at:27:491; Interrogation_Position=976; Antisense; GTACAAAGGGCTCGTTCCCAAGATT
>probe:Drosophila_2:1624971_at:204:251; Interrogation_Position=994; Antisense; CAAGATTATGCGTTTGGGCCCAGGT

Paste this into a BLAST search page for me
GAGCTATTCTGCTGCTGGTCTTCGATGGTCTTCGAGTACTCCTACGATTATACTCCTAGTCCTTAAGTCCTCAAGAGAGGCAAGCGCCTTCTTTGTTTTTGATTAGTCGCGATCAATGCCATCAAGATGCTACTCTTCCGATTGTGATTCTTCAACATGGTGTACTTCGGGTTCTTTCGGGTTCTACCACAGCGTGAAGAGTGAAGAACGTGGTGCCCGAGTACAGGAGTTTCTGCGCAAGGTGACCATCATGGGCATCGTCTACCGCGAGGAAGGGAAGGATTCCGAGCGCTGTACAAAGTACAAAGGGCTCGTTCCCAAGATTCAAGATTATGCGTTTGGGCCCAGGT

Full Affymetrix probeset data:

Annotations for 1624971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720