FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624975_at:

>probe:Drosophila_2:1624975_at:197:67; Interrogation_Position=311; Antisense; ATGGCACCAACAACTACGTTCGAAA
>probe:Drosophila_2:1624975_at:473:7; Interrogation_Position=344; Antisense; ATTGCTGTATTTCCGTGGGCTTGGC
>probe:Drosophila_2:1624975_at:427:91; Interrogation_Position=419; Antisense; AGTTGTATTCAGCTTGGCAAGGCCA
>probe:Drosophila_2:1624975_at:633:563; Interrogation_Position=434; Antisense; GGCAAGGCCACGGAGCTTATTTAAA
>probe:Drosophila_2:1624975_at:284:133; Interrogation_Position=465; Antisense; ACCCATTGAGGTTTCCAACGCTAAG
>probe:Drosophila_2:1624975_at:650:3; Interrogation_Position=504; Antisense; ATTGGTGTGCTATGAGATCTCCCTA
>probe:Drosophila_2:1624975_at:202:95; Interrogation_Position=518; Antisense; AGATCTCCCTAATCGTGGTGTCTAA
>probe:Drosophila_2:1624975_at:302:511; Interrogation_Position=559; Antisense; GTGAAGCGTCTCTACAAGCTGGCCT
>probe:Drosophila_2:1624975_at:312:99; Interrogation_Position=649; Antisense; AGATGTGACGCCTATCATGTGGAGA
>probe:Drosophila_2:1624975_at:298:41; Interrogation_Position=689; Antisense; ATCTGGCTGGCGGTGCGGTAATCCT
>probe:Drosophila_2:1624975_at:636:483; Interrogation_Position=706; Antisense; GTAATCCTCAGGGAAGCCGGTGGCA
>probe:Drosophila_2:1624975_at:583:581; Interrogation_Position=726; Antisense; TGGCAGGGTATATCACACAAGCGGT
>probe:Drosophila_2:1624975_at:474:445; Interrogation_Position=765; Antisense; GATGAAACCCGACTGTGTGTGCACC
>probe:Drosophila_2:1624975_at:599:517; Interrogation_Position=779; Antisense; GTGTGTGCACCAGCTCTGAAGAATT

Paste this into a BLAST search page for me
ATGGCACCAACAACTACGTTCGAAAATTGCTGTATTTCCGTGGGCTTGGCAGTTGTATTCAGCTTGGCAAGGCCAGGCAAGGCCACGGAGCTTATTTAAAACCCATTGAGGTTTCCAACGCTAAGATTGGTGTGCTATGAGATCTCCCTAAGATCTCCCTAATCGTGGTGTCTAAGTGAAGCGTCTCTACAAGCTGGCCTAGATGTGACGCCTATCATGTGGAGAATCTGGCTGGCGGTGCGGTAATCCTGTAATCCTCAGGGAAGCCGGTGGCATGGCAGGGTATATCACACAAGCGGTGATGAAACCCGACTGTGTGTGCACCGTGTGTGCACCAGCTCTGAAGAATT

Full Affymetrix probeset data:

Annotations for 1624975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720