FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624976_at:

>probe:Drosophila_2:1624976_at:44:615; Interrogation_Position=1808; Antisense; TGAAGAGTCCACCATGACTACCGTC
>probe:Drosophila_2:1624976_at:670:277; Interrogation_Position=1825; Antisense; CTACCGTCTGTCTGAATATTGTCCA
>probe:Drosophila_2:1624976_at:119:123; Interrogation_Position=1858; Antisense; AGCGATACGATATGCTGGTGCTGCC
>probe:Drosophila_2:1624976_at:506:529; Interrogation_Position=1894; Antisense; GGGATATCATTTCGGACACCTGCGC
>probe:Drosophila_2:1624976_at:189:231; Interrogation_Position=1956; Antisense; AATGTAGGCACCAATGGCGCCATTT
>probe:Drosophila_2:1624976_at:73:315; Interrogation_Position=1974; Antisense; GCCATTTTCGAGTCCGTTCACGGAA
>probe:Drosophila_2:1624976_at:57:385; Interrogation_Position=1996; Antisense; GAACTGCGCCTGATATTGCTGGCAA
>probe:Drosophila_2:1624976_at:675:705; Interrogation_Position=2043; Antisense; TTACTGCTTTCCTCCGTGATGATGC
>probe:Drosophila_2:1624976_at:629:355; Interrogation_Position=2069; Antisense; GCACTACATCGGATTGCATGAGCAT
>probe:Drosophila_2:1624976_at:519:453; Interrogation_Position=2136; Antisense; GATAATATTCGCACCATGGATCTGG
>probe:Drosophila_2:1624976_at:401:565; Interrogation_Position=2163; Antisense; GGCAAGGCCAAATGCTCCGAGTACA
>probe:Drosophila_2:1624976_at:405:447; Interrogation_Position=2190; Antisense; GATGCCCTGATCAAAAACCTTAAGT
>probe:Drosophila_2:1624976_at:65:363; Interrogation_Position=2233; Antisense; GCAATGCTTTTTTATCTTTCAACTC
>probe:Drosophila_2:1624976_at:431:237; Interrogation_Position=2281; Antisense; AATCGGTCCTTGTATGATCTTCATG

Paste this into a BLAST search page for me
TGAAGAGTCCACCATGACTACCGTCCTACCGTCTGTCTGAATATTGTCCAAGCGATACGATATGCTGGTGCTGCCGGGATATCATTTCGGACACCTGCGCAATGTAGGCACCAATGGCGCCATTTGCCATTTTCGAGTCCGTTCACGGAAGAACTGCGCCTGATATTGCTGGCAATTACTGCTTTCCTCCGTGATGATGCGCACTACATCGGATTGCATGAGCATGATAATATTCGCACCATGGATCTGGGGCAAGGCCAAATGCTCCGAGTACAGATGCCCTGATCAAAAACCTTAAGTGCAATGCTTTTTTATCTTTCAACTCAATCGGTCCTTGTATGATCTTCATG

Full Affymetrix probeset data:

Annotations for 1624976_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720