Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624978_at:

>probe:Drosophila_2:1624978_at:422:535; Interrogation_Position=1191; Antisense; GGTGCATCAACCATGTGTGTACATT
>probe:Drosophila_2:1624978_at:284:151; Interrogation_Position=1211; Antisense; ACATTTTGCATGTTACTCGCCCTAG
>probe:Drosophila_2:1624978_at:347:649; Interrogation_Position=1236; Antisense; TCAGCATCACTCTTTTGCAACACAT
>probe:Drosophila_2:1624978_at:225:359; Interrogation_Position=1252; Antisense; GCAACACATCTGCATTTGGATTACC
>probe:Drosophila_2:1624978_at:721:541; Interrogation_Position=1269; Antisense; GGATTACCTTATTCGTCCAGGAGAG
>probe:Drosophila_2:1624978_at:288:607; Interrogation_Position=1305; Antisense; TGATGATCTCCATCCAACTCTAGTG
>probe:Drosophila_2:1624978_at:630:191; Interrogation_Position=1320; Antisense; AACTCTAGTGGTTCAAGTGCCGTTA
>probe:Drosophila_2:1624978_at:319:507; Interrogation_Position=1336; Antisense; GTGCCGTTAACTTCGCTTGGATATA
>probe:Drosophila_2:1624978_at:640:565; Interrogation_Position=1401; Antisense; GGCAATGTTTGCTGATAGGTCCAAT
>probe:Drosophila_2:1624978_at:473:679; Interrogation_Position=1416; Antisense; TAGGTCCAATCATACAAGCCCCATA
>probe:Drosophila_2:1624978_at:311:365; Interrogation_Position=1487; Antisense; GAATATTGCTTGAAACTCGGCGGTT
>probe:Drosophila_2:1624978_at:66:21; Interrogation_Position=1582; Antisense; ATTTGCAGTGCAATTGCCATCTCCA
>probe:Drosophila_2:1624978_at:177:629; Interrogation_Position=1603; Antisense; TCCACTTCGTTCTTGAGCTTTCAAA
>probe:Drosophila_2:1624978_at:213:315; Interrogation_Position=1641; Antisense; GCGACCGAAGTCTCTAACATTTTGG

Paste this into a BLAST search page for me
GGTGCATCAACCATGTGTGTACATTACATTTTGCATGTTACTCGCCCTAGTCAGCATCACTCTTTTGCAACACATGCAACACATCTGCATTTGGATTACCGGATTACCTTATTCGTCCAGGAGAGTGATGATCTCCATCCAACTCTAGTGAACTCTAGTGGTTCAAGTGCCGTTAGTGCCGTTAACTTCGCTTGGATATAGGCAATGTTTGCTGATAGGTCCAATTAGGTCCAATCATACAAGCCCCATAGAATATTGCTTGAAACTCGGCGGTTATTTGCAGTGCAATTGCCATCTCCATCCACTTCGTTCTTGAGCTTTCAAAGCGACCGAAGTCTCTAACATTTTGG

Full Affymetrix probeset data:

Annotations for 1624978_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime