FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624979_at:

>probe:Drosophila_2:1624979_at:727:119; Interrogation_Position=113; Antisense; AGCTGACTCCCACTCAGGTGAAGGA
>probe:Drosophila_2:1624979_at:257:81; Interrogation_Position=128; Antisense; AGGTGAAGGACCAGCCCACTGTCGT
>probe:Drosophila_2:1624979_at:594:437; Interrogation_Position=217; Antisense; GAGGACCCCAAGTTCCGTGAGCTGC
>probe:Drosophila_2:1624979_at:306:621; Interrogation_Position=239; Antisense; TGCTCCACTGGCTGGTGATCAACAT
>probe:Drosophila_2:1624979_at:566:513; Interrogation_Position=253; Antisense; GTGATCAACATTCCCGGCAACAAGG
>probe:Drosophila_2:1624979_at:659:185; Interrogation_Position=271; Antisense; AACAAGGTGTCCGAGGGCCAGACCA
>probe:Drosophila_2:1624979_at:288:703; Interrogation_Position=29; Antisense; TTATTCCCGACATCATCGACGTCAA
>probe:Drosophila_2:1624979_at:574:669; Interrogation_Position=346; Antisense; TACGTCTTCCTGGTGTTCAAGCAGA
>probe:Drosophila_2:1624979_at:612:109; Interrogation_Position=389; Antisense; AGAAGTTCGTGTCCAAGACCAGCCG
>probe:Drosophila_2:1624979_at:655:109; Interrogation_Position=452; Antisense; AGAAGTACAGCTTCGGCGGTCCCGT
>probe:Drosophila_2:1624979_at:205:717; Interrogation_Position=490; Antisense; TTCCAGGCCCAATACGATGACTACG
>probe:Drosophila_2:1624979_at:129:609; Interrogation_Position=507; Antisense; TGACTACGTGAAGACCCTCATCGAG
>probe:Drosophila_2:1624979_at:666:89; Interrogation_Position=539; Antisense; AGTAATCTGGCCACCAACTGATCAG
>probe:Drosophila_2:1624979_at:302:669; Interrogation_Position=79; Antisense; TATCCTTCCGGCGTTCAGGTTGAGC

Paste this into a BLAST search page for me
AGCTGACTCCCACTCAGGTGAAGGAAGGTGAAGGACCAGCCCACTGTCGTGAGGACCCCAAGTTCCGTGAGCTGCTGCTCCACTGGCTGGTGATCAACATGTGATCAACATTCCCGGCAACAAGGAACAAGGTGTCCGAGGGCCAGACCATTATTCCCGACATCATCGACGTCAATACGTCTTCCTGGTGTTCAAGCAGAAGAAGTTCGTGTCCAAGACCAGCCGAGAAGTACAGCTTCGGCGGTCCCGTTTCCAGGCCCAATACGATGACTACGTGACTACGTGAAGACCCTCATCGAGAGTAATCTGGCCACCAACTGATCAGTATCCTTCCGGCGTTCAGGTTGAGC

Full Affymetrix probeset data:

Annotations for 1624979_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720