Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624983_s_at:

>probe:Drosophila_2:1624983_s_at:512:359; Interrogation_Position=134; Antisense; GCAAGCGCAAGGTTGGCATCGCCAT
>probe:Drosophila_2:1624983_s_at:520:269; Interrogation_Position=165; Antisense; CATCAAGGGAGTGGGTCGCCGCTAC
>probe:Drosophila_2:1624983_s_at:341:303; Interrogation_Position=183; Antisense; CCGCTACTCCAACATTGTGCTGAAG
>probe:Drosophila_2:1624983_s_at:632:225; Interrogation_Position=208; Antisense; AAGGCCGATGTCGATCTTACCAAGC
>probe:Drosophila_2:1624983_s_at:63:39; Interrogation_Position=280; Antisense; ATCTCGAACCCTCTGCAGTACAAGG
>probe:Drosophila_2:1624983_s_at:186:349; Interrogation_Position=294; Antisense; GCAGTACAAGGTGCCCAACTGGTTC
>probe:Drosophila_2:1624983_s_at:150:255; Interrogation_Position=309; Antisense; CAACTGGTTCCTCAACAGGCAGAAG
>probe:Drosophila_2:1624983_s_at:324:637; Interrogation_Position=341; Antisense; TCGATGGCAAGTACTGGCAGCTGAC
>probe:Drosophila_2:1624983_s_at:294:191; Interrogation_Position=373; Antisense; AACTTGGACTCGAAGCTGCGTGACG
>probe:Drosophila_2:1624983_s_at:196:503; Interrogation_Position=497; Antisense; GTCGCACCGTGGGTGTGTCCAAGAA
>probe:Drosophila_2:1624983_s_at:470:371; Interrogation_Position=522; Antisense; GAAGTAAGCTTAGCAGCGTTCCCTG
>probe:Drosophila_2:1624983_s_at:344:195; Interrogation_Position=61; Antisense; AACGGCAAAATGTCGCTCGTCATCC
>probe:Drosophila_2:1624983_s_at:433:497; Interrogation_Position=79; Antisense; GTCATCCCAGAGAAGTTCCAGCACA
>probe:Drosophila_2:1624983_s_at:615:307; Interrogation_Position=96; Antisense; CCAGCACATCCTGCGTATCATGAAT

Paste this into a BLAST search page for me
GCAAGCGCAAGGTTGGCATCGCCATCATCAAGGGAGTGGGTCGCCGCTACCCGCTACTCCAACATTGTGCTGAAGAAGGCCGATGTCGATCTTACCAAGCATCTCGAACCCTCTGCAGTACAAGGGCAGTACAAGGTGCCCAACTGGTTCCAACTGGTTCCTCAACAGGCAGAAGTCGATGGCAAGTACTGGCAGCTGACAACTTGGACTCGAAGCTGCGTGACGGTCGCACCGTGGGTGTGTCCAAGAAGAAGTAAGCTTAGCAGCGTTCCCTGAACGGCAAAATGTCGCTCGTCATCCGTCATCCCAGAGAAGTTCCAGCACACCAGCACATCCTGCGTATCATGAAT

Full Affymetrix probeset data:

Annotations for 1624983_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime