FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624984_at:

>probe:Drosophila_2:1624984_at:81:311; Interrogation_Position=121; Antisense; GCCAACGCGGAGGTGGTCTTTGACC
>probe:Drosophila_2:1624984_at:435:61; Interrogation_Position=13; Antisense; ATGTCCAGCGGATTTGTTCGCAGCA
>probe:Drosophila_2:1624984_at:497:477; Interrogation_Position=136; Antisense; GTCTTTGACCGGCAACTGGGCCTGT
>probe:Drosophila_2:1624984_at:11:575; Interrogation_Position=154; Antisense; GGCCTGTCCAAGCACTATGGCTTTG
>probe:Drosophila_2:1624984_at:721:355; Interrogation_Position=165; Antisense; GCACTATGGCTTTGTGGTTTTCAGC
>probe:Drosophila_2:1624984_at:67:591; Interrogation_Position=179; Antisense; TGGTTTTCAGCCAACGGGATGCCTT
>probe:Drosophila_2:1624984_at:480:529; Interrogation_Position=194; Antisense; GGGATGCCTTCAACAGCGCCAGCAA
>probe:Drosophila_2:1624984_at:3:189; Interrogation_Position=223; Antisense; AACACCCATTTCCTCGATGGACGAG
>probe:Drosophila_2:1624984_at:273:433; Interrogation_Position=245; Antisense; GAGTGCTCACAGTCCAGCGGGCGAA
>probe:Drosophila_2:1624984_at:354:261; Interrogation_Position=259; Antisense; CAGCGGGCGAATGAAAGTCCTCAGA
>probe:Drosophila_2:1624984_at:436:339; Interrogation_Position=38; Antisense; GCTACAAATTGTTCGTCGGCAACCT
>probe:Drosophila_2:1624984_at:162:637; Interrogation_Position=53; Antisense; TCGGCAACCTGCCATGGACGATAGG
>probe:Drosophila_2:1624984_at:568:225; Interrogation_Position=82; Antisense; AAGGAACTGCGGACCTACTTCTCAA
>probe:Drosophila_2:1624984_at:132:669; Interrogation_Position=97; Antisense; TACTTCTCAAAGTACGGGCACGTGG

Paste this into a BLAST search page for me
GCCAACGCGGAGGTGGTCTTTGACCATGTCCAGCGGATTTGTTCGCAGCAGTCTTTGACCGGCAACTGGGCCTGTGGCCTGTCCAAGCACTATGGCTTTGGCACTATGGCTTTGTGGTTTTCAGCTGGTTTTCAGCCAACGGGATGCCTTGGGATGCCTTCAACAGCGCCAGCAAAACACCCATTTCCTCGATGGACGAGGAGTGCTCACAGTCCAGCGGGCGAACAGCGGGCGAATGAAAGTCCTCAGAGCTACAAATTGTTCGTCGGCAACCTTCGGCAACCTGCCATGGACGATAGGAAGGAACTGCGGACCTACTTCTCAATACTTCTCAAAGTACGGGCACGTGG

Full Affymetrix probeset data:

Annotations for 1624984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720