Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624985_at:

>probe:Drosophila_2:1624985_at:362:405; Interrogation_Position=2898; Antisense; GACGGACTCCACGTTACTTAGTAGC
>probe:Drosophila_2:1624985_at:241:679; Interrogation_Position=2916; Antisense; TAGTAGCTCGAAATACTCCTCCATG
>probe:Drosophila_2:1624985_at:721:51; Interrogation_Position=2938; Antisense; ATGCATGTCTTTGTGCGGCGCAAGC
>probe:Drosophila_2:1624985_at:557:287; Interrogation_Position=2953; Antisense; CGGCGCAAGCAATCGGAGTCCATGT
>probe:Drosophila_2:1624985_at:597:281; Interrogation_Position=3024; Antisense; CTCTGGCGATTTCGGCGACCAAAAT
>probe:Drosophila_2:1624985_at:586:183; Interrogation_Position=3044; Antisense; AAAATGTCATATCCCCGGCCAATGT
>probe:Drosophila_2:1624985_at:189:511; Interrogation_Position=3120; Antisense; GTGACTTTAGGTTCCTCCATTCAAA
>probe:Drosophila_2:1624985_at:104:121; Interrogation_Position=3183; Antisense; AGCTGGCTGATACGCCGAGCAGTAA
>probe:Drosophila_2:1624985_at:202:257; Interrogation_Position=3246; Antisense; CAAAGCAGCCAACTCGATTCGATAG
>probe:Drosophila_2:1624985_at:365:463; Interrogation_Position=3261; Antisense; GATTCGATAGGATCCCCACTGGGAG
>probe:Drosophila_2:1624985_at:418:661; Interrogation_Position=3289; Antisense; TAAATTTGCAGTCATACTCCCGGGC
>probe:Drosophila_2:1624985_at:174:29; Interrogation_Position=3302; Antisense; ATACTCCCGGGCAGTAGCAGTAGAA
>probe:Drosophila_2:1624985_at:302:505; Interrogation_Position=3351; Antisense; GTCCTGCCATCTGCGAATTCAAGCT
>probe:Drosophila_2:1624985_at:719:95; Interrogation_Position=3425; Antisense; AGATTTATTATTTGTGTGCTCCCTA

Paste this into a BLAST search page for me
GACGGACTCCACGTTACTTAGTAGCTAGTAGCTCGAAATACTCCTCCATGATGCATGTCTTTGTGCGGCGCAAGCCGGCGCAAGCAATCGGAGTCCATGTCTCTGGCGATTTCGGCGACCAAAATAAAATGTCATATCCCCGGCCAATGTGTGACTTTAGGTTCCTCCATTCAAAAGCTGGCTGATACGCCGAGCAGTAACAAAGCAGCCAACTCGATTCGATAGGATTCGATAGGATCCCCACTGGGAGTAAATTTGCAGTCATACTCCCGGGCATACTCCCGGGCAGTAGCAGTAGAAGTCCTGCCATCTGCGAATTCAAGCTAGATTTATTATTTGTGTGCTCCCTA

Full Affymetrix probeset data:

Annotations for 1624985_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime