FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624986_at:

>probe:Drosophila_2:1624986_at:245:115; Interrogation_Position=391; Antisense; AGCTCCCTGGCCACCGAGTGGGTGA
>probe:Drosophila_2:1624986_at:636:219; Interrogation_Position=421; Antisense; AAGTCCATCGACGAGGCCGGAAAGC
>probe:Drosophila_2:1624986_at:609:365; Interrogation_Position=450; Antisense; GAATACGGACATCGCCAAGGAGCTG
>probe:Drosophila_2:1624986_at:342:619; Interrogation_Position=494; Antisense; TGCATTGCTCCATGCTGGCCGAGGA
>probe:Drosophila_2:1624986_at:588:577; Interrogation_Position=531; Antisense; GGCCCTGGCTGACTACAAGGTCAAG
>probe:Drosophila_2:1624986_at:4:555; Interrogation_Position=608; Antisense; GGAGCGTTTCTCTGAACAACTACTA
>probe:Drosophila_2:1624986_at:510:15; Interrogation_Position=715; Antisense; ATTATTGTTCGCTAGAGCTCTGTGA
>probe:Drosophila_2:1624986_at:371:281; Interrogation_Position=732; Antisense; CTCTGTGAGTGATTGGCCGCGTGAC
>probe:Drosophila_2:1624986_at:189:581; Interrogation_Position=745; Antisense; TGGCCGCGTGACTGCTGATAAGTGC
>probe:Drosophila_2:1624986_at:181:71; Interrogation_Position=780; Antisense; AGGAATCGTCTGTCATTGATACTAA
>probe:Drosophila_2:1624986_at:226:79; Interrogation_Position=805; Antisense; AGGATAGCTGGAACTGATCTTGTAT
>probe:Drosophila_2:1624986_at:107:369; Interrogation_Position=830; Antisense; GAATGCATATGCACGTGTGTGTTTT
>probe:Drosophila_2:1624986_at:568:363; Interrogation_Position=861; Antisense; GAATTCTAAGTAGTCCCGAGAGCTA
>probe:Drosophila_2:1624986_at:31:665; Interrogation_Position=888; Antisense; TAAATTTTCCGTTCTGTTATGCGAA

Paste this into a BLAST search page for me
AGCTCCCTGGCCACCGAGTGGGTGAAAGTCCATCGACGAGGCCGGAAAGCGAATACGGACATCGCCAAGGAGCTGTGCATTGCTCCATGCTGGCCGAGGAGGCCCTGGCTGACTACAAGGTCAAGGGAGCGTTTCTCTGAACAACTACTAATTATTGTTCGCTAGAGCTCTGTGACTCTGTGAGTGATTGGCCGCGTGACTGGCCGCGTGACTGCTGATAAGTGCAGGAATCGTCTGTCATTGATACTAAAGGATAGCTGGAACTGATCTTGTATGAATGCATATGCACGTGTGTGTTTTGAATTCTAAGTAGTCCCGAGAGCTATAAATTTTCCGTTCTGTTATGCGAA

Full Affymetrix probeset data:

Annotations for 1624986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720