FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624987_at:

>probe:Drosophila_2:1624987_at:117:261; Interrogation_Position=1833; Antisense; CAGTGCCACTTTGAAAACCGTATGA
>probe:Drosophila_2:1624987_at:686:75; Interrogation_Position=1870; Antisense; AGGAGCTCCTTCTGCTTGACAGGAA
>probe:Drosophila_2:1624987_at:158:193; Interrogation_Position=1893; Antisense; AACTATTTGTTCGAGCAGATTGCCA
>probe:Drosophila_2:1624987_at:25:531; Interrogation_Position=1919; Antisense; GGGTATCCTCAGCTATGCGGTTAAT
>probe:Drosophila_2:1624987_at:133:539; Interrogation_Position=1937; Antisense; GGTTAATCCGCTCAACTATCAGTCG
>probe:Drosophila_2:1624987_at:459:145; Interrogation_Position=1951; Antisense; ACTATCAGTCGGTGCTTAAGCTGGC
>probe:Drosophila_2:1624987_at:427:417; Interrogation_Position=1979; Antisense; GAGCGTCCAGTCGTGTGAAATCATC
>probe:Drosophila_2:1624987_at:456:113; Interrogation_Position=2014; Antisense; AGCAGACGATGCTCAAGCCAGGCAT
>probe:Drosophila_2:1624987_at:106:29; Interrogation_Position=2109; Antisense; ATACCCTAGGATCCTGTCAAGCAGA
>probe:Drosophila_2:1624987_at:155:173; Interrogation_Position=2156; Antisense; AAAGCAGGATGCCTTAGCTCTGGCG
>probe:Drosophila_2:1624987_at:549:117; Interrogation_Position=2171; Antisense; AGCTCTGGCGGGAAGTAGCCCTAAA
>probe:Drosophila_2:1624987_at:381:709; Interrogation_Position=2198; Antisense; TTACTTGTATATTTCGTTTCCGAGG
>probe:Drosophila_2:1624987_at:236:695; Interrogation_Position=2214; Antisense; TTTCCGAGGCACTTACATACTTCAG
>probe:Drosophila_2:1624987_at:51:27; Interrogation_Position=2345; Antisense; ATCAGACACCTGGATCCTTTAGTTA

Paste this into a BLAST search page for me
CAGTGCCACTTTGAAAACCGTATGAAGGAGCTCCTTCTGCTTGACAGGAAAACTATTTGTTCGAGCAGATTGCCAGGGTATCCTCAGCTATGCGGTTAATGGTTAATCCGCTCAACTATCAGTCGACTATCAGTCGGTGCTTAAGCTGGCGAGCGTCCAGTCGTGTGAAATCATCAGCAGACGATGCTCAAGCCAGGCATATACCCTAGGATCCTGTCAAGCAGAAAAGCAGGATGCCTTAGCTCTGGCGAGCTCTGGCGGGAAGTAGCCCTAAATTACTTGTATATTTCGTTTCCGAGGTTTCCGAGGCACTTACATACTTCAGATCAGACACCTGGATCCTTTAGTTA

Full Affymetrix probeset data:

Annotations for 1624987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720