FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624991_at:

>probe:Drosophila_2:1624991_at:217:211; Interrogation_Position=121; Antisense; AAGAAGTGCATCCAGAAGCCGGGAA
>probe:Drosophila_2:1624991_at:286:203; Interrogation_Position=136; Antisense; AAGCCGGGAAAATCACTGGACTCCA
>probe:Drosophila_2:1624991_at:174:587; Interrogation_Position=152; Antisense; TGGACTCCACCGAGCAGCGTTGCAT
>probe:Drosophila_2:1624991_at:421:113; Interrogation_Position=164; Antisense; AGCAGCGTTGCATTTCGCAGTGCAT
>probe:Drosophila_2:1624991_at:52:19; Interrogation_Position=175; Antisense; ATTTCGCAGTGCATGGATCGCTTCA
>probe:Drosophila_2:1624991_at:103:589; Interrogation_Position=188; Antisense; TGGATCGCTTCATGGACGCCTGGAA
>probe:Drosophila_2:1624991_at:43:283; Interrogation_Position=20; Antisense; CTGCCAACATGGAGAAGGGTGAGCT
>probe:Drosophila_2:1624991_at:266:135; Interrogation_Position=203; Antisense; ACGCCTGGAATCTGGTGTCGCGCAC
>probe:Drosophila_2:1624991_at:395:277; Interrogation_Position=228; Antisense; CTATGGCAATCGTCTGCAGCGTGAA
>probe:Drosophila_2:1624991_at:542:617; Interrogation_Position=242; Antisense; TGCAGCGTGAACAGTACAGGACCAT
>probe:Drosophila_2:1624991_at:467:151; Interrogation_Position=252; Antisense; ACAGTACAGGACCATGGAATCGTTG
>probe:Drosophila_2:1624991_at:84:563; Interrogation_Position=267; Antisense; GGAATCGTTGGAGATGACCAGCTAG
>probe:Drosophila_2:1624991_at:548:389; Interrogation_Position=57; Antisense; GAAACAACAGATCGCATTGGCCAAT
>probe:Drosophila_2:1624991_at:62:235; Interrogation_Position=79; Antisense; AATGCCCAGGAGATGCTCTCGAAGA

Paste this into a BLAST search page for me
AAGAAGTGCATCCAGAAGCCGGGAAAAGCCGGGAAAATCACTGGACTCCATGGACTCCACCGAGCAGCGTTGCATAGCAGCGTTGCATTTCGCAGTGCATATTTCGCAGTGCATGGATCGCTTCATGGATCGCTTCATGGACGCCTGGAACTGCCAACATGGAGAAGGGTGAGCTACGCCTGGAATCTGGTGTCGCGCACCTATGGCAATCGTCTGCAGCGTGAATGCAGCGTGAACAGTACAGGACCATACAGTACAGGACCATGGAATCGTTGGGAATCGTTGGAGATGACCAGCTAGGAAACAACAGATCGCATTGGCCAATAATGCCCAGGAGATGCTCTCGAAGA

Full Affymetrix probeset data:

Annotations for 1624991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720