FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624993_at:

>probe:Drosophila_2:1624993_at:214:313; Interrogation_Position=186; Antisense; GCCACCGTTAGCTGTTCTGATAGAC
>probe:Drosophila_2:1624993_at:348:407; Interrogation_Position=213; Antisense; GACGTTTGCGTCACCATTTATGAGG
>probe:Drosophila_2:1624993_at:628:415; Interrogation_Position=252; Antisense; GAGCGCGGTTGCTTTTCTCAAATCT
>probe:Drosophila_2:1624993_at:39:653; Interrogation_Position=269; Antisense; TCAAATCTCTTTGGCTGGTCAAGCG
>probe:Drosophila_2:1624993_at:114:251; Interrogation_Position=378; Antisense; CAATGCATTGGTTCTGATTCAGCTG
>probe:Drosophila_2:1624993_at:20:605; Interrogation_Position=401; Antisense; TGATTGCAACAAGGGTGCCACCGCC
>probe:Drosophila_2:1624993_at:251:303; Interrogation_Position=460; Antisense; CCGCCAATTCCTACTGTTATGTCAA
>probe:Drosophila_2:1624993_at:261:475; Interrogation_Position=475; Antisense; GTTATGTCAAGGTAGTCGGCGATCA
>probe:Drosophila_2:1624993_at:325:437; Interrogation_Position=517; Antisense; GAGGATGTGCTCTTTCTGTTAAGGA
>probe:Drosophila_2:1624993_at:112:371; Interrogation_Position=545; Antisense; GAAGGCCTGCTTGGAGGACTCGAAA
>probe:Drosophila_2:1624993_at:39:287; Interrogation_Position=605; Antisense; CGTGGCCTGCAACAACTACGATTTG
>probe:Drosophila_2:1624993_at:312:247; Interrogation_Position=631; Antisense; AATTGGGACCCAAGTCCTCAGCTGA
>probe:Drosophila_2:1624993_at:593:161; Interrogation_Position=667; Antisense; AACTCTTGAGCTACGGGTTGGCTTT
>probe:Drosophila_2:1624993_at:18:307; Interrogation_Position=698; Antisense; CCTGCTCTCGCTTAAATTGCTGAAT

Paste this into a BLAST search page for me
GCCACCGTTAGCTGTTCTGATAGACGACGTTTGCGTCACCATTTATGAGGGAGCGCGGTTGCTTTTCTCAAATCTTCAAATCTCTTTGGCTGGTCAAGCGCAATGCATTGGTTCTGATTCAGCTGTGATTGCAACAAGGGTGCCACCGCCCCGCCAATTCCTACTGTTATGTCAAGTTATGTCAAGGTAGTCGGCGATCAGAGGATGTGCTCTTTCTGTTAAGGAGAAGGCCTGCTTGGAGGACTCGAAACGTGGCCTGCAACAACTACGATTTGAATTGGGACCCAAGTCCTCAGCTGAAACTCTTGAGCTACGGGTTGGCTTTCCTGCTCTCGCTTAAATTGCTGAAT

Full Affymetrix probeset data:

Annotations for 1624993_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720