FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624994_at:

>probe:Drosophila_2:1624994_at:645:361; Interrogation_Position=2533; Antisense; GAATTGGCCAGACACCTGCGCAATG
>probe:Drosophila_2:1624994_at:48:363; Interrogation_Position=2552; Antisense; GCAATGTCTTCGTTACCGAGCGTAA
>probe:Drosophila_2:1624994_at:671:431; Interrogation_Position=2579; Antisense; GAGTGCTCACCCTGGAAGTAATCAT
>probe:Drosophila_2:1624994_at:254:215; Interrogation_Position=2608; Antisense; AAGATCCAGAACAGCTTCCGGGCGA
>probe:Drosophila_2:1624994_at:495:439; Interrogation_Position=2653; Antisense; GAGGCGCATCTGAAACTACTTGCCA
>probe:Drosophila_2:1624994_at:67:525; Interrogation_Position=2693; Antisense; GGGCTTCCTTTCATGAAGTGCGCAA
>probe:Drosophila_2:1624994_at:427:411; Interrogation_Position=2718; Antisense; GACCATGTACCTCAAGGTTGCCAAG
>probe:Drosophila_2:1624994_at:692:411; Interrogation_Position=2854; Antisense; GACCCTGTGGCTATATCCAGATATA
>probe:Drosophila_2:1624994_at:230:217; Interrogation_Position=2884; Antisense; AAGTACTTGTCAAACTCGCTGGCCA
>probe:Drosophila_2:1624994_at:495:145; Interrogation_Position=2897; Antisense; ACTCGCTGGCCATTACTTGATTAAA
>probe:Drosophila_2:1624994_at:677:71; Interrogation_Position=2932; Antisense; AGGCTAACCATCTTGACATTTCCAC
>probe:Drosophila_2:1624994_at:20:19; Interrogation_Position=2949; Antisense; ATTTCCACATTCAACAAGCACCTTG
>probe:Drosophila_2:1624994_at:283:543; Interrogation_Position=2986; Antisense; GGATTCATCACATTTACCCAAGCAA
>probe:Drosophila_2:1624994_at:477:411; Interrogation_Position=3075; Antisense; GACCATTTTCATGTTGTACCACGTT

Paste this into a BLAST search page for me
GAATTGGCCAGACACCTGCGCAATGGCAATGTCTTCGTTACCGAGCGTAAGAGTGCTCACCCTGGAAGTAATCATAAGATCCAGAACAGCTTCCGGGCGAGAGGCGCATCTGAAACTACTTGCCAGGGCTTCCTTTCATGAAGTGCGCAAGACCATGTACCTCAAGGTTGCCAAGGACCCTGTGGCTATATCCAGATATAAAGTACTTGTCAAACTCGCTGGCCAACTCGCTGGCCATTACTTGATTAAAAGGCTAACCATCTTGACATTTCCACATTTCCACATTCAACAAGCACCTTGGGATTCATCACATTTACCCAAGCAAGACCATTTTCATGTTGTACCACGTT

Full Affymetrix probeset data:

Annotations for 1624994_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720