FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624995_at:

>probe:Drosophila_2:1624995_at:293:157; Interrogation_Position=121; Antisense; AAATGGTTAGATCGCGCTTTTCCTG
>probe:Drosophila_2:1624995_at:221:699; Interrogation_Position=138; Antisense; TTTTCCTGGCACCACTAAGGTTATC
>probe:Drosophila_2:1624995_at:519:341; Interrogation_Position=180; Antisense; GCTTGATCAGTTTGTACTAACGCCT
>probe:Drosophila_2:1624995_at:630:145; Interrogation_Position=195; Antisense; ACTAACGCCTTATCTATTGACTGTG
>probe:Drosophila_2:1624995_at:216:269; Interrogation_Position=240; Antisense; CATGGAGGGCTCTGCGGATATTTTC
>probe:Drosophila_2:1624995_at:401:543; Interrogation_Position=255; Antisense; GGATATTTTCCTGGAACTCCGCGAA
>probe:Drosophila_2:1624995_at:533:245; Interrogation_Position=281; Antisense; AATTCGTGCCGACTTTTATGCGTTC
>probe:Drosophila_2:1624995_at:409:705; Interrogation_Position=296; Antisense; TTATGCGTTCCTGCATTTTCTGGTT
>probe:Drosophila_2:1624995_at:314:575; Interrogation_Position=330; Antisense; GGCCTTGAACTTTTCCCTGGTTGCA
>probe:Drosophila_2:1624995_at:444:293; Interrogation_Position=358; Antisense; CGATTCCGTGTCATCTATATGGGTA
>probe:Drosophila_2:1624995_at:289:567; Interrogation_Position=425; Antisense; GGCAAAGTCTTCCAGTCGCAACGAA
>probe:Drosophila_2:1624995_at:86:389; Interrogation_Position=54; Antisense; GAAAAGCACGCAACGCACTGAGAAA
>probe:Drosophila_2:1624995_at:49:457; Interrogation_Position=552; Antisense; GATAGTTTTTGACCATGCATTGCCA
>probe:Drosophila_2:1624995_at:127:397; Interrogation_Position=75; Antisense; GAAATTGGGCATATTTGCACGACAT

Paste this into a BLAST search page for me
AAATGGTTAGATCGCGCTTTTCCTGTTTTCCTGGCACCACTAAGGTTATCGCTTGATCAGTTTGTACTAACGCCTACTAACGCCTTATCTATTGACTGTGCATGGAGGGCTCTGCGGATATTTTCGGATATTTTCCTGGAACTCCGCGAAAATTCGTGCCGACTTTTATGCGTTCTTATGCGTTCCTGCATTTTCTGGTTGGCCTTGAACTTTTCCCTGGTTGCACGATTCCGTGTCATCTATATGGGTAGGCAAAGTCTTCCAGTCGCAACGAAGAAAAGCACGCAACGCACTGAGAAAGATAGTTTTTGACCATGCATTGCCAGAAATTGGGCATATTTGCACGACAT

Full Affymetrix probeset data:

Annotations for 1624995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720