Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1624996_at:

>probe:Drosophila_2:1624996_at:151:581; Interrogation_Position=2981; Antisense; TGGCCTTCTTGTCCAAGGTCGAGCA
>probe:Drosophila_2:1624996_at:370:393; Interrogation_Position=3024; Antisense; GAAAGAGCCAAATCCCCTGCTCATT
>probe:Drosophila_2:1624996_at:317:147; Interrogation_Position=3060; Antisense; ACTCAGTTGGCATTTGTTGCGGCAC
>probe:Drosophila_2:1624996_at:310:167; Interrogation_Position=3085; Antisense; AAATGTGATCAGGTCCGCCAACTGG
>probe:Drosophila_2:1624996_at:232:433; Interrogation_Position=3214; Antisense; GAGGGACTGATTTACACGCTGACAT
>probe:Drosophila_2:1624996_at:425:283; Interrogation_Position=3232; Antisense; CTGACATCGGGCGTGCTGAAACTAA
>probe:Drosophila_2:1624996_at:316:435; Interrogation_Position=3295; Antisense; GAGGGATTCCTTGAAGCGCTGCTCA
>probe:Drosophila_2:1624996_at:140:287; Interrogation_Position=3325; Antisense; CTGGATGTCACTGAGCGAGTTCGTC
>probe:Drosophila_2:1624996_at:158:429; Interrogation_Position=3341; Antisense; GAGTTCGTCGCTTCAAGCCGTACAC
>probe:Drosophila_2:1624996_at:709:229; Interrogation_Position=3370; Antisense; AATGTGCTGCTGGAACTGCTAGGCC
>probe:Drosophila_2:1624996_at:99:195; Interrogation_Position=3383; Antisense; AACTGCTAGGCCAGCTGGGTAGTGC
>probe:Drosophila_2:1624996_at:578:543; Interrogation_Position=3408; Antisense; GGATAAAGCGGCTCTCGTCGAGTCT
>probe:Drosophila_2:1624996_at:538:431; Interrogation_Position=3427; Antisense; GAGTCTCTCGGCTAGCATTAGCAAA
>probe:Drosophila_2:1624996_at:143:93; Interrogation_Position=3488; Antisense; AGTTATCTTTCCTTGTCAACGCTTT

Paste this into a BLAST search page for me
TGGCCTTCTTGTCCAAGGTCGAGCAGAAAGAGCCAAATCCCCTGCTCATTACTCAGTTGGCATTTGTTGCGGCACAAATGTGATCAGGTCCGCCAACTGGGAGGGACTGATTTACACGCTGACATCTGACATCGGGCGTGCTGAAACTAAGAGGGATTCCTTGAAGCGCTGCTCACTGGATGTCACTGAGCGAGTTCGTCGAGTTCGTCGCTTCAAGCCGTACACAATGTGCTGCTGGAACTGCTAGGCCAACTGCTAGGCCAGCTGGGTAGTGCGGATAAAGCGGCTCTCGTCGAGTCTGAGTCTCTCGGCTAGCATTAGCAAAAGTTATCTTTCCTTGTCAACGCTTT

Full Affymetrix probeset data:

Annotations for 1624996_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime