Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625000_a_at:

>probe:Drosophila_2:1625000_a_at:235:543; Interrogation_Position=180; Antisense; GGATTACAGTGGAGCTCCAGCACTC
>probe:Drosophila_2:1625000_a_at:615:145; Interrogation_Position=201; Antisense; ACTCGCTGGCTGCAAACTCGGAAAG
>probe:Drosophila_2:1625000_a_at:607:391; Interrogation_Position=221; Antisense; GAAAGTTTCTCCTTCCGCGGGAATG
>probe:Drosophila_2:1625000_a_at:714:369; Interrogation_Position=241; Antisense; GAATGTGACGATTCCCAGTCTCAAC
>probe:Drosophila_2:1625000_a_at:47:653; Interrogation_Position=261; Antisense; TCAACTCTGGTCTGGCCAATGTGGA
>probe:Drosophila_2:1625000_a_at:687:111; Interrogation_Position=285; Antisense; AGCAACCAGATCTGAGCACTGCCGA
>probe:Drosophila_2:1625000_a_at:399:143; Interrogation_Position=302; Antisense; ACTGCCGATCTGGACTTGCTGAAGA
>probe:Drosophila_2:1625000_a_at:445:577; Interrogation_Position=330; Antisense; TGGCCCTTGGAAACGAGTTCTACCG
>probe:Drosophila_2:1625000_a_at:279:93; Interrogation_Position=396; Antisense; AGTTCATCACTTCCAACAAGGCCTG
>probe:Drosophila_2:1625000_a_at:537:367; Interrogation_Position=442; Antisense; GAATGACGTGCTTTGGGTGTCGCTC
>probe:Drosophila_2:1625000_a_at:215:29; Interrogation_Position=478; Antisense; ATACGTAACCGGCATCACTGTGTCC
>probe:Drosophila_2:1625000_a_at:534:391; Interrogation_Position=560; Antisense; GAAACGCAATTCAGCACCGATGTCC
>probe:Drosophila_2:1625000_a_at:575:623; Interrogation_Position=612; Antisense; TGCCCGATACTGCTGGCTTTATTCA
>probe:Drosophila_2:1625000_a_at:147:31; Interrogation_Position=684; Antisense; ATAACCGCGGCTTCTTTGCCAAATA

Paste this into a BLAST search page for me
GGATTACAGTGGAGCTCCAGCACTCACTCGCTGGCTGCAAACTCGGAAAGGAAAGTTTCTCCTTCCGCGGGAATGGAATGTGACGATTCCCAGTCTCAACTCAACTCTGGTCTGGCCAATGTGGAAGCAACCAGATCTGAGCACTGCCGAACTGCCGATCTGGACTTGCTGAAGATGGCCCTTGGAAACGAGTTCTACCGAGTTCATCACTTCCAACAAGGCCTGGAATGACGTGCTTTGGGTGTCGCTCATACGTAACCGGCATCACTGTGTCCGAAACGCAATTCAGCACCGATGTCCTGCCCGATACTGCTGGCTTTATTCAATAACCGCGGCTTCTTTGCCAAATA

Full Affymetrix probeset data:

Annotations for 1625000_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime