Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625002_a_at:

>probe:Drosophila_2:1625002_a_at:297:511; Interrogation_Position=1051; Antisense; GTGACAGCCAGCATCTACTTGTTAA
>probe:Drosophila_2:1625002_a_at:527:655; Interrogation_Position=1073; Antisense; TAAGGCATTTTTGTACTCCCCATTT
>probe:Drosophila_2:1625002_a_at:729:177; Interrogation_Position=572; Antisense; AAACTGGGATACGATCTCCTCATCA
>probe:Drosophila_2:1625002_a_at:379:311; Interrogation_Position=602; Antisense; GCCAACGATTGCACACGATTCTACA
>probe:Drosophila_2:1625002_a_at:389:11; Interrogation_Position=644; Antisense; ATCAAGGGCGTCAATACGTCCGTAG
>probe:Drosophila_2:1625002_a_at:353:363; Interrogation_Position=691; Antisense; GAATATTGTATTGCCCGCGAAACCC
>probe:Drosophila_2:1625002_a_at:455:295; Interrogation_Position=706; Antisense; CGCGAAACCCGAGAGTGTGGCCATT
>probe:Drosophila_2:1625002_a_at:624:63; Interrogation_Position=744; Antisense; ATGGTGGCAGTCTTACTCTTGATTT
>probe:Drosophila_2:1625002_a_at:575:169; Interrogation_Position=794; Antisense; AAAGAATCCGTTTTTGCCATTGCCT
>probe:Drosophila_2:1625002_a_at:155:91; Interrogation_Position=861; Antisense; AGTACCTGTGCGATGTGGCCTGCGA
>probe:Drosophila_2:1625002_a_at:256:317; Interrogation_Position=878; Antisense; GCCTGCGATTGGGTTGCCAGCAACA
>probe:Drosophila_2:1625002_a_at:305:141; Interrogation_Position=912; Antisense; ACACACCCGTTTCACAGTCAAAGAG
>probe:Drosophila_2:1625002_a_at:304:209; Interrogation_Position=968; Antisense; AAGCACGAATGGACCTCTTACTCGG
>probe:Drosophila_2:1625002_a_at:287:315; Interrogation_Position=992; Antisense; GCCATCGATTCCGTGTTCAAGTTCA

Paste this into a BLAST search page for me
GTGACAGCCAGCATCTACTTGTTAATAAGGCATTTTTGTACTCCCCATTTAAACTGGGATACGATCTCCTCATCAGCCAACGATTGCACACGATTCTACAATCAAGGGCGTCAATACGTCCGTAGGAATATTGTATTGCCCGCGAAACCCCGCGAAACCCGAGAGTGTGGCCATTATGGTGGCAGTCTTACTCTTGATTTAAAGAATCCGTTTTTGCCATTGCCTAGTACCTGTGCGATGTGGCCTGCGAGCCTGCGATTGGGTTGCCAGCAACAACACACCCGTTTCACAGTCAAAGAGAAGCACGAATGGACCTCTTACTCGGGCCATCGATTCCGTGTTCAAGTTCA

Full Affymetrix probeset data:

Annotations for 1625002_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime