FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625003_at:

>probe:Drosophila_2:1625003_at:237:499; Interrogation_Position=1614; Antisense; GTCTAGCTTTTTTGTTTGCCTTCTA
>probe:Drosophila_2:1625003_at:482:531; Interrogation_Position=1693; Antisense; GGTCTGGGCATTGCCGGCTACTACA
>probe:Drosophila_2:1625003_at:237:667; Interrogation_Position=1711; Antisense; TACTACAACCTGCTGTACTTCTCGC
>probe:Drosophila_2:1625003_at:600:619; Interrogation_Position=1742; Antisense; TGCTCTACCTAAACTCAGCCATGAA
>probe:Drosophila_2:1625003_at:84:607; Interrogation_Position=1784; Antisense; TGATGTCCTCCAAATTTCGCAGCGG
>probe:Drosophila_2:1625003_at:506:335; Interrogation_Position=1821; Antisense; GCTGCTCACTTGTCTGGGCCAACGG
>probe:Drosophila_2:1625003_at:365:35; Interrogation_Position=1874; Antisense; ATCAGAGGCAGCATCCAACGGCAGG
>probe:Drosophila_2:1625003_at:730:51; Interrogation_Position=1913; Antisense; ATGCGTCCACGCGACAGGAACAGGA
>probe:Drosophila_2:1625003_at:587:129; Interrogation_Position=2011; Antisense; ACCTTCTTGATCAACTCCATATCCA
>probe:Drosophila_2:1625003_at:709:639; Interrogation_Position=2041; Antisense; TCGGGTACGGATCGCACCACATCAT
>probe:Drosophila_2:1625003_at:417:37; Interrogation_Position=2061; Antisense; ATCATCATCGGCGTGGCGCAGCAAC
>probe:Drosophila_2:1625003_at:202:597; Interrogation_Position=2090; Antisense; TGTCCATTTCCGGTCTGAGCGAACG
>probe:Drosophila_2:1625003_at:712:569; Interrogation_Position=2122; Antisense; GGCATACTGGGAGCCGCTATCATCG
>probe:Drosophila_2:1625003_at:552:665; Interrogation_Position=2166; Antisense; TACAACCGCCTGTCTGCAGGAGCGA

Paste this into a BLAST search page for me
GTCTAGCTTTTTTGTTTGCCTTCTAGGTCTGGGCATTGCCGGCTACTACATACTACAACCTGCTGTACTTCTCGCTGCTCTACCTAAACTCAGCCATGAATGATGTCCTCCAAATTTCGCAGCGGGCTGCTCACTTGTCTGGGCCAACGGATCAGAGGCAGCATCCAACGGCAGGATGCGTCCACGCGACAGGAACAGGAACCTTCTTGATCAACTCCATATCCATCGGGTACGGATCGCACCACATCATATCATCATCGGCGTGGCGCAGCAACTGTCCATTTCCGGTCTGAGCGAACGGGCATACTGGGAGCCGCTATCATCGTACAACCGCCTGTCTGCAGGAGCGA

Full Affymetrix probeset data:

Annotations for 1625003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720