Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625004_at:

>probe:Drosophila_2:1625004_at:465:689; Interrogation_Position=3207; Antisense; TATTGTTACGCAAACCACTCTCAAC
>probe:Drosophila_2:1625004_at:184:107; Interrogation_Position=3255; Antisense; AAAGAATCCTTTATAACGCAACTAG
>probe:Drosophila_2:1625004_at:428:257; Interrogation_Position=3300; Antisense; CACACAAATCAATTCGTGCGCATTT
>probe:Drosophila_2:1625004_at:178:507; Interrogation_Position=3315; Antisense; GTGCGCATTTTTCAATACGATTTAT
>probe:Drosophila_2:1625004_at:266:139; Interrogation_Position=3331; Antisense; ACGATTTATACCTATTTCCCTTGAT
>probe:Drosophila_2:1625004_at:517:631; Interrogation_Position=3347; Antisense; TCCCTTGATTTTGGTTTATTCGATA
>probe:Drosophila_2:1625004_at:19:387; Interrogation_Position=3433; Antisense; GAAAGTAAGCGCTCCAAGGGTTTCT
>probe:Drosophila_2:1625004_at:112:539; Interrogation_Position=3451; Antisense; GGTTTCTAAAACTCCCAGACAGGAT
>probe:Drosophila_2:1625004_at:110:73; Interrogation_Position=3476; Antisense; AGGACAGGACACAACACTACTTCGT
>probe:Drosophila_2:1625004_at:565:149; Interrogation_Position=3530; Antisense; ACTTGTATGTAACTTGGATCTGCCA
>probe:Drosophila_2:1625004_at:556:545; Interrogation_Position=3545; Antisense; GGATCTGCCATTTCTTGCTTGATTT
>probe:Drosophila_2:1625004_at:492:667; Interrogation_Position=3570; Antisense; TACTTTTTGTCTGTTTGGCTGCGTT
>probe:Drosophila_2:1625004_at:21:679; Interrogation_Position=3734; Antisense; TAGTTTGTGCTCTTACTGTCATGCT
>probe:Drosophila_2:1625004_at:256:645; Interrogation_Position=3758; Antisense; TCTATCCCATTTCAACACCTTTTTT

Paste this into a BLAST search page for me
TATTGTTACGCAAACCACTCTCAACAAAGAATCCTTTATAACGCAACTAGCACACAAATCAATTCGTGCGCATTTGTGCGCATTTTTCAATACGATTTATACGATTTATACCTATTTCCCTTGATTCCCTTGATTTTGGTTTATTCGATAGAAAGTAAGCGCTCCAAGGGTTTCTGGTTTCTAAAACTCCCAGACAGGATAGGACAGGACACAACACTACTTCGTACTTGTATGTAACTTGGATCTGCCAGGATCTGCCATTTCTTGCTTGATTTTACTTTTTGTCTGTTTGGCTGCGTTTAGTTTGTGCTCTTACTGTCATGCTTCTATCCCATTTCAACACCTTTTTT

Full Affymetrix probeset data:

Annotations for 1625004_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime