FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625006_at:

>probe:Drosophila_2:1625006_at:188:499; Interrogation_Position=1105; Antisense; GTCTGCACGCTAACCAATCACAAGA
>probe:Drosophila_2:1625006_at:166:253; Interrogation_Position=1125; Antisense; CAAGAAGTCCGTGCGCAGCATAGTC
>probe:Drosophila_2:1625006_at:16:663; Interrogation_Position=1191; Antisense; TAACATCAAGCAGTGGCGCTGTCCG
>probe:Drosophila_2:1625006_at:59:217; Interrogation_Position=1222; Antisense; AAGTTTGTGCAGAACATCTCCGGCC
>probe:Drosophila_2:1625006_at:633:273; Interrogation_Position=1254; Antisense; CATTGTCAATTGCATGGCGGCGAAT
>probe:Drosophila_2:1625006_at:333:141; Interrogation_Position=1310; Antisense; ACGGCACGATGTTCTTTTGGGACTG
>probe:Drosophila_2:1625006_at:126:729; Interrogation_Position=1326; Antisense; TTGGGACTGGCGTACCGGCTACAAT
>probe:Drosophila_2:1625006_at:529:571; Interrogation_Position=1342; Antisense; GGCTACAATTTCCAGCGGTTCCAAG
>probe:Drosophila_2:1625006_at:28:631; Interrogation_Position=1384; Antisense; TCCATGGACAGCGAGGCGGGCATAT
>probe:Drosophila_2:1625006_at:517:21; Interrogation_Position=1405; Antisense; ATATTCGCCATGTGCTTCGATCAAT
>probe:Drosophila_2:1625006_at:418:437; Interrogation_Position=1501; Antisense; GAGGAGTCGCATCCGATTAACTGGC
>probe:Drosophila_2:1625006_at:340:13; Interrogation_Position=1516; Antisense; ATTAACTGGCGACCGGATCTACTGA
>probe:Drosophila_2:1625006_at:408:205; Interrogation_Position=1540; Antisense; AAGCGCCGCAAATTCTAGACTCCTA
>probe:Drosophila_2:1625006_at:631:405; Interrogation_Position=1557; Antisense; GACTCCTAGTTTGTAAGCCTATCCA

Paste this into a BLAST search page for me
GTCTGCACGCTAACCAATCACAAGACAAGAAGTCCGTGCGCAGCATAGTCTAACATCAAGCAGTGGCGCTGTCCGAAGTTTGTGCAGAACATCTCCGGCCCATTGTCAATTGCATGGCGGCGAATACGGCACGATGTTCTTTTGGGACTGTTGGGACTGGCGTACCGGCTACAATGGCTACAATTTCCAGCGGTTCCAAGTCCATGGACAGCGAGGCGGGCATATATATTCGCCATGTGCTTCGATCAATGAGGAGTCGCATCCGATTAACTGGCATTAACTGGCGACCGGATCTACTGAAAGCGCCGCAAATTCTAGACTCCTAGACTCCTAGTTTGTAAGCCTATCCA

Full Affymetrix probeset data:

Annotations for 1625006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720