FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625011_at:

>probe:Drosophila_2:1625011_at:511:463; Interrogation_Position=4246; Antisense; GATTGCGTGACGGTAATATACTCAC
>probe:Drosophila_2:1625011_at:21:687; Interrogation_Position=4262; Antisense; TATACTCACTGAATTACAAGCCGAT
>probe:Drosophila_2:1625011_at:339:707; Interrogation_Position=4275; Antisense; TTACAAGCCGATTTGGGCACTGGAG
>probe:Drosophila_2:1625011_at:492:567; Interrogation_Position=4290; Antisense; GGCACTGGAGATGCGATTGCAATTT
>probe:Drosophila_2:1625011_at:220:491; Interrogation_Position=4335; Antisense; GTAACCGAAACTATCGTAGCTAAGC
>probe:Drosophila_2:1625011_at:329:97; Interrogation_Position=4402; Antisense; AGATGCGGCACTTTGTAAATTATGA
>probe:Drosophila_2:1625011_at:539:703; Interrogation_Position=4421; Antisense; TTATGATAAGCCCTAAGCAACGTTC
>probe:Drosophila_2:1625011_at:98:359; Interrogation_Position=4437; Antisense; GCAACGTTCAATATCGCATGGTAAT
>probe:Drosophila_2:1625011_at:614:393; Interrogation_Position=4537; Antisense; GAAAGTCAGTCAGCCTGCTTTATCC
>probe:Drosophila_2:1625011_at:164:343; Interrogation_Position=4553; Antisense; GCTTTATCCGCCAATCAATCAGTAT
>probe:Drosophila_2:1625011_at:509:239; Interrogation_Position=4569; Antisense; AATCAGTATCGAAGAATCCCCGAGA
>probe:Drosophila_2:1625011_at:70:47; Interrogation_Position=4584; Antisense; ATCCCCGAGAGCGTCAGGGTATCAT
>probe:Drosophila_2:1625011_at:445:81; Interrogation_Position=4599; Antisense; AGGGTATCATTAAGCTGACCAATTT
>probe:Drosophila_2:1625011_at:300:333; Interrogation_Position=4612; Antisense; GCTGACCAATTTAACTGTAGACCTA

Paste this into a BLAST search page for me
GATTGCGTGACGGTAATATACTCACTATACTCACTGAATTACAAGCCGATTTACAAGCCGATTTGGGCACTGGAGGGCACTGGAGATGCGATTGCAATTTGTAACCGAAACTATCGTAGCTAAGCAGATGCGGCACTTTGTAAATTATGATTATGATAAGCCCTAAGCAACGTTCGCAACGTTCAATATCGCATGGTAATGAAAGTCAGTCAGCCTGCTTTATCCGCTTTATCCGCCAATCAATCAGTATAATCAGTATCGAAGAATCCCCGAGAATCCCCGAGAGCGTCAGGGTATCATAGGGTATCATTAAGCTGACCAATTTGCTGACCAATTTAACTGTAGACCTA

Full Affymetrix probeset data:

Annotations for 1625011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720