FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625014_at:

>probe:Drosophila_2:1625014_at:432:61; Interrogation_Position=1239; Antisense; ATGTCGCCGGAAACATTGCAGCGCA
>probe:Drosophila_2:1625014_at:612:41; Interrogation_Position=1273; Antisense; ATCGAAACTGGGAGGCCTGTGACAT
>probe:Drosophila_2:1625014_at:436:703; Interrogation_Position=1315; Antisense; TTATTTGGGAGCTGACTACGCGCGA
>probe:Drosophila_2:1625014_at:620:501; Interrogation_Position=1358; Antisense; GTCGCCCATGGAGTGCGGCATGAAA
>probe:Drosophila_2:1625014_at:490:77; Interrogation_Position=1394; Antisense; AGGTCTGCGGGTCAAGATTCCGCCA
>probe:Drosophila_2:1625014_at:67:581; Interrogation_Position=1436; Antisense; GGCCAAGCTGATTTCAATCTGCATG
>probe:Drosophila_2:1625014_at:623:237; Interrogation_Position=1451; Antisense; AATCTGCATGAACGAGGATCCCGGC
>probe:Drosophila_2:1625014_at:122:217; Interrogation_Position=1485; Antisense; AAGTTCGACATGGTGGTTCCCATTC
>probe:Drosophila_2:1625014_at:325:673; Interrogation_Position=1619; Antisense; TACCTTTGTCTAACTGAGCCTAACC
>probe:Drosophila_2:1625014_at:263:251; Interrogation_Position=1668; Antisense; CAAGTGCAACTGCTCTGTCTAGAGT
>probe:Drosophila_2:1625014_at:531:101; Interrogation_Position=1688; Antisense; AGAGTTTATGTTTCTGTGTCTCACT
>probe:Drosophila_2:1625014_at:319:515; Interrogation_Position=1703; Antisense; GTGTCTCACTGTTCTCTACTTATGA
>probe:Drosophila_2:1625014_at:404:641; Interrogation_Position=1717; Antisense; TCTACTTATGATTTTCCGTCGATGT
>probe:Drosophila_2:1625014_at:195:675; Interrogation_Position=1743; Antisense; TAGTGCGGGTGCTCGATTTTTTACT

Paste this into a BLAST search page for me
ATGTCGCCGGAAACATTGCAGCGCAATCGAAACTGGGAGGCCTGTGACATTTATTTGGGAGCTGACTACGCGCGAGTCGCCCATGGAGTGCGGCATGAAAAGGTCTGCGGGTCAAGATTCCGCCAGGCCAAGCTGATTTCAATCTGCATGAATCTGCATGAACGAGGATCCCGGCAAGTTCGACATGGTGGTTCCCATTCTACCTTTGTCTAACTGAGCCTAACCCAAGTGCAACTGCTCTGTCTAGAGTAGAGTTTATGTTTCTGTGTCTCACTGTGTCTCACTGTTCTCTACTTATGATCTACTTATGATTTTCCGTCGATGTTAGTGCGGGTGCTCGATTTTTTACT

Full Affymetrix probeset data:

Annotations for 1625014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720