FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625016_at:

>probe:Drosophila_2:1625016_at:233:93; Interrogation_Position=1009; Antisense; AGTTCTTCGAGTACCGCTTCAGCTG
>probe:Drosophila_2:1625016_at:194:101; Interrogation_Position=1050; Antisense; AGAGGAGTATTCTTCGTTCGCGACG
>probe:Drosophila_2:1625016_at:337:207; Interrogation_Position=1152; Antisense; AAGCTGGCTGACAGGAGCATCTTCA
>probe:Drosophila_2:1625016_at:305:419; Interrogation_Position=1166; Antisense; GAGCATCTTCAGTTTCTACGGCAGA
>probe:Drosophila_2:1625016_at:518:201; Interrogation_Position=600; Antisense; AACCCCTTTAGTGGCCAACAGCTGG
>probe:Drosophila_2:1625016_at:308:407; Interrogation_Position=658; Antisense; GACGGCAGCCCGTGAACGGTAACAT
>probe:Drosophila_2:1625016_at:536:537; Interrogation_Position=675; Antisense; GGTAACATCGTAGAGCTACCCCAGC
>probe:Drosophila_2:1625016_at:663:583; Interrogation_Position=751; Antisense; TGGCTCTGGGACTCGGCGAATCAGC
>probe:Drosophila_2:1625016_at:49:577; Interrogation_Position=765; Antisense; GGCGAATCAGCCAACCAGCGGTTGT
>probe:Drosophila_2:1625016_at:601:499; Interrogation_Position=823; Antisense; GTCTGCGCCTCAGCGTCGAGATAAA
>probe:Drosophila_2:1625016_at:481:663; Interrogation_Position=844; Antisense; TAAACCAGCGCAAGGTGGCAACCTT
>probe:Drosophila_2:1625016_at:206:153; Interrogation_Position=940; Antisense; ACATCCGTGCGTTCGGCGAGGGCAA
>probe:Drosophila_2:1625016_at:650:265; Interrogation_Position=969; Antisense; CAGATATGTCTGTCGGTGGTCTTTA
>probe:Drosophila_2:1625016_at:481:537; Interrogation_Position=986; Antisense; GGTCTTTAAAGTTCTGGCCAGCCAG

Paste this into a BLAST search page for me
AGTTCTTCGAGTACCGCTTCAGCTGAGAGGAGTATTCTTCGTTCGCGACGAAGCTGGCTGACAGGAGCATCTTCAGAGCATCTTCAGTTTCTACGGCAGAAACCCCTTTAGTGGCCAACAGCTGGGACGGCAGCCCGTGAACGGTAACATGGTAACATCGTAGAGCTACCCCAGCTGGCTCTGGGACTCGGCGAATCAGCGGCGAATCAGCCAACCAGCGGTTGTGTCTGCGCCTCAGCGTCGAGATAAATAAACCAGCGCAAGGTGGCAACCTTACATCCGTGCGTTCGGCGAGGGCAACAGATATGTCTGTCGGTGGTCTTTAGGTCTTTAAAGTTCTGGCCAGCCAG

Full Affymetrix probeset data:

Annotations for 1625016_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720