FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625017_at:

>probe:Drosophila_2:1625017_at:492:675; Interrogation_Position=1003; Antisense; TAGCTGCAACCGTACCCTTTAGGAA
>probe:Drosophila_2:1625017_at:150:561; Interrogation_Position=1024; Antisense; GGAACTTCTCTTTAATTGCGTCTGT
>probe:Drosophila_2:1625017_at:357:329; Interrogation_Position=1041; Antisense; GCGTCTGTTTTTACACATTTTTCTA
>probe:Drosophila_2:1625017_at:87:343; Interrogation_Position=1076; Antisense; GCTTGCCTTCTTATTTATTTGCCAG
>probe:Drosophila_2:1625017_at:139:19; Interrogation_Position=1092; Antisense; ATTTGCCAGTATGCGCTCAGATGAT
>probe:Drosophila_2:1625017_at:206:435; Interrogation_Position=1132; Antisense; GATGTCCAGCCTAACTCTTAAAGTA
>probe:Drosophila_2:1625017_at:485:211; Interrogation_Position=652; Antisense; AAGAAGCGAAAGCACGGCGAGCATA
>probe:Drosophila_2:1625017_at:547:321; Interrogation_Position=693; Antisense; GCCCAGAAGGTCTAGCCGAGATGAG
>probe:Drosophila_2:1625017_at:659:373; Interrogation_Position=802; Antisense; GAAGTCACTTCCACGGATGTCAAGA
>probe:Drosophila_2:1625017_at:483:255; Interrogation_Position=828; Antisense; CAAAGAGGGCACTGGCAATGGCGAC
>probe:Drosophila_2:1625017_at:703:395; Interrogation_Position=850; Antisense; GACAAGGAGCGCAAGCGTACCTCAC
>probe:Drosophila_2:1625017_at:413:123; Interrogation_Position=928; Antisense; AGCGACTCTTCGTCGAGCAGCTCGA
>probe:Drosophila_2:1625017_at:7:573; Interrogation_Position=967; Antisense; GGCGGCAGGCGGAAAACCTCCTCGT
>probe:Drosophila_2:1625017_at:101:281; Interrogation_Position=987; Antisense; CTCGTCGGGCAGACGTTAGCTGCAA

Paste this into a BLAST search page for me
TAGCTGCAACCGTACCCTTTAGGAAGGAACTTCTCTTTAATTGCGTCTGTGCGTCTGTTTTTACACATTTTTCTAGCTTGCCTTCTTATTTATTTGCCAGATTTGCCAGTATGCGCTCAGATGATGATGTCCAGCCTAACTCTTAAAGTAAAGAAGCGAAAGCACGGCGAGCATAGCCCAGAAGGTCTAGCCGAGATGAGGAAGTCACTTCCACGGATGTCAAGACAAAGAGGGCACTGGCAATGGCGACGACAAGGAGCGCAAGCGTACCTCACAGCGACTCTTCGTCGAGCAGCTCGAGGCGGCAGGCGGAAAACCTCCTCGTCTCGTCGGGCAGACGTTAGCTGCAA

Full Affymetrix probeset data:

Annotations for 1625017_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720