FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625019_at:

>probe:Drosophila_2:1625019_at:123:531; Interrogation_Position=1022; Antisense; GGGTTATCGTGGACTACATCCTGCG
>probe:Drosophila_2:1625019_at:14:545; Interrogation_Position=1158; Antisense; GGATCACTACGCCTTGGGTGCAGTA
>probe:Drosophila_2:1625019_at:661:349; Interrogation_Position=1177; Antisense; GCAGTATTCACCGTTGTCTAGTATT
>probe:Drosophila_2:1625019_at:5:239; Interrogation_Position=1203; Antisense; AATCTCTTCATGCTTTCTTGGACTC
>probe:Drosophila_2:1625019_at:408:669; Interrogation_Position=680; Antisense; TACTCAATCGCGACAATGTGGCCTT
>probe:Drosophila_2:1625019_at:606:273; Interrogation_Position=702; Antisense; CTTGTTTGCCAGGTTCCGATTCAAA
>probe:Drosophila_2:1625019_at:223:265; Interrogation_Position=742; Antisense; CAGAAGGAATTCGTGGTCGCCACCA
>probe:Drosophila_2:1625019_at:216:261; Interrogation_Position=765; Antisense; CACGCACTTGCTGTTCAACACGAAA
>probe:Drosophila_2:1625019_at:346:277; Interrogation_Position=860; Antisense; CTATCGTCCTGACTGGTGACTTTAA
>probe:Drosophila_2:1625019_at:79:533; Interrogation_Position=874; Antisense; GGTGACTTTAACAGTCTGCCCGACT
>probe:Drosophila_2:1625019_at:192:301; Interrogation_Position=902; Antisense; CGCCTATTGAATTCCTCGTTGGCAA
>probe:Drosophila_2:1625019_at:428:593; Interrogation_Position=936; Antisense; TGTGGATTCCACAGCTTGCCCAGAA
>probe:Drosophila_2:1625019_at:525:107; Interrogation_Position=957; Antisense; AGAACCCCTGCATTTCGAGATCATC
>probe:Drosophila_2:1625019_at:358:463; Interrogation_Position=982; Antisense; GATTCGGGCGAAGGTACTGCCTCCA

Paste this into a BLAST search page for me
GGGTTATCGTGGACTACATCCTGCGGGATCACTACGCCTTGGGTGCAGTAGCAGTATTCACCGTTGTCTAGTATTAATCTCTTCATGCTTTCTTGGACTCTACTCAATCGCGACAATGTGGCCTTCTTGTTTGCCAGGTTCCGATTCAAACAGAAGGAATTCGTGGTCGCCACCACACGCACTTGCTGTTCAACACGAAACTATCGTCCTGACTGGTGACTTTAAGGTGACTTTAACAGTCTGCCCGACTCGCCTATTGAATTCCTCGTTGGCAATGTGGATTCCACAGCTTGCCCAGAAAGAACCCCTGCATTTCGAGATCATCGATTCGGGCGAAGGTACTGCCTCCA

Full Affymetrix probeset data:

Annotations for 1625019_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720