FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625020_at:

>probe:Drosophila_2:1625020_at:588:149; Interrogation_Position=132; Antisense; ACTTCAGGCGATCCAGTCAGCGTGA
>probe:Drosophila_2:1625020_at:276:267; Interrogation_Position=145; Antisense; CAGTCAGCGTGATCGGTTGCCCAGG
>probe:Drosophila_2:1625020_at:676:539; Interrogation_Position=159; Antisense; GGTTGCCCAGGCTGAGTAGCTCGTC
>probe:Drosophila_2:1625020_at:500:675; Interrogation_Position=175; Antisense; TAGCTCGTCCACCATGGATGTGGCA
>probe:Drosophila_2:1625020_at:303:595; Interrogation_Position=193; Antisense; TGTGGCACCTCGCTTTCAGAGAATA
>probe:Drosophila_2:1625020_at:627:239; Interrogation_Position=214; Antisense; AATACGACGCGGGAGCACTTGCGAG
>probe:Drosophila_2:1625020_at:34:465; Interrogation_Position=318; Antisense; GATTGCGTCGTGTCCTCGAGATCTA
>probe:Drosophila_2:1625020_at:383:97; Interrogation_Position=336; Antisense; AGATCTATATGCCACGATTCCAGCC
>probe:Drosophila_2:1625020_at:679:383; Interrogation_Position=407; Antisense; GAACTTGGCGAGTCAGCCAGGACAC
>probe:Drosophila_2:1625020_at:582:553; Interrogation_Position=433; Antisense; GGAGCCACAGGAAGCTCTGCCCATT
>probe:Drosophila_2:1625020_at:305:441; Interrogation_Position=507; Antisense; GATGGCATCTTGCTTGGATTTGCTT
>probe:Drosophila_2:1625020_at:443:541; Interrogation_Position=522; Antisense; GGATTTGCTTAACGACCACTTGATG
>probe:Drosophila_2:1625020_at:664:525; Interrogation_Position=78; Antisense; GGGAATTCCTTTGGTTACTTGCCAT
>probe:Drosophila_2:1625020_at:509:667; Interrogation_Position=93; Antisense; TACTTGCCATGTACCATTCTTCAGG

Paste this into a BLAST search page for me
ACTTCAGGCGATCCAGTCAGCGTGACAGTCAGCGTGATCGGTTGCCCAGGGGTTGCCCAGGCTGAGTAGCTCGTCTAGCTCGTCCACCATGGATGTGGCATGTGGCACCTCGCTTTCAGAGAATAAATACGACGCGGGAGCACTTGCGAGGATTGCGTCGTGTCCTCGAGATCTAAGATCTATATGCCACGATTCCAGCCGAACTTGGCGAGTCAGCCAGGACACGGAGCCACAGGAAGCTCTGCCCATTGATGGCATCTTGCTTGGATTTGCTTGGATTTGCTTAACGACCACTTGATGGGGAATTCCTTTGGTTACTTGCCATTACTTGCCATGTACCATTCTTCAGG

Full Affymetrix probeset data:

Annotations for 1625020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720